| Species | ANI | Abundance | Accession |
|---|---|---|---|
Plasmodium falciparum |
99.8 % |
35.68 |
Plasmodium_falciparum |
3 tables.
1. Indicating drug resistant markers
2. Other variants encountered
3. Areas which were missing when analysing
4. Variants that failed the quality control report
Next| Drug | Mutations |
|---|---|
|
Chloroquine |
MDR1 p.Asn86Tyr (1.00) , MDR1 p.Tyr184Phe (1.00) , CRT p.Met74Ile (1.00) , CRT p.Lys76Thr (1.00) , CRT p.Ala220Ser (1.00) , CRT p.Gln271Glu (1.00) |
|
Mefloquine |
|
|
Pyrimethamine |
|
|
Sulfadoxine |
PPPK-DHPS p.Ala437Gly (0.97) |
|
Artemisinin |
| Chromosome: | Genome Position | Locus Tag | Gene Name | Change | Estimated fraction |
|---|---|---|---|---|---|
| Pf3D7_01_v3 | 190616 | PF3D7_0104300 | UBP1 | c.348A>G | 1.0 |
| Pf3D7_01_v3 | 190739 | PF3D7_0104300 | UBP1 | p.Asn157Lys | 1.0 |
| Pf3D7_01_v3 | 190967 | PF3D7_0104300 | UBP1 | c.699_700insAATAGTATTAATAATAGTATTAAT | 0.57 |
| Pf3D7_01_v3 | 191432 | PF3D7_0104300 | UBP1 | c.1162_1164dupGAT | 0.83 |
| Pf3D7_01_v3 | 192111 | PF3D7_0104300 | UBP1 | p.Tyr615His | 1.0 |
| Pf3D7_01_v3 | 193667 | PF3D7_0104300 | UBP1 | p.Arg1133Ser | 0.95 |
| Pf3D7_01_v3 | 194117 | PF3D7_0104300 | UBP1 | c.3849T>C | 1.0 |
| Pf3D7_01_v3 | 196010 | PF3D7_0104300 | UBP1 | p.Lys1914Asn | 1.0 |
| Pf3D7_01_v3 | 196011 | PF3D7_0104300 | UBP1 | p.Glu1915Lys | 1.0 |
| Pf3D7_01_v3 | 196981 | PF3D7_0104300 | UBP1 | p.Arg2238Lys | 0.98 |
| Pf3D7_01_v3 | 199865 | PF3D7_0104300 | UBP1 | c.9365_9391delGTATGAATCATGCAAACCGTGTGAGTC | 0.53 |
| Pf3D7_01_v3 | 380532 | PF3D7_0109800 | PF3D7_0109800 | c.-165A>G | 1.0 |
| Pf3D7_01_v3 | 381402 | PF3D7_0109800 | PF3D7_0109800 | c.704_706dupATA | 0.94 |
| Pf3D7_03_v3 | 922867 | PF3D7_0321900 | CARL | c.-106_-105delAT | 0.95 |
| Pf3D7_03_v3 | 925808 | PF3D7_0321900 | CARL | p.Lys903Glu | 1.0 |
| Pf3D7_04_v3 | 748516 | PF3D7_0417200 | DHFR-TS | c.429T>C | 0.98 |
| Pf3D7_05_v3 | 410338 | PF3D7_0509800 | PI4K | p.His24Leu | 1.0 |
| Pf3D7_05_v3 | 412895 | PF3D7_0509800 | PI4K | c.2628C>T | 0.76 |
| Pf3D7_05_v3 | 412896 | PF3D7_0509800 | PI4K | p.Asn877Asp | 0.76 |
| Pf3D7_05_v3 | 413426 | PF3D7_0509800 | PI4K | c.3159C>T | 0.97 |
| Pf3D7_05_v3 | 413958 | PF3D7_0509800 | PI4K | c.3689_3691dupATA | 1.0 |
| Pf3D7_05_v3 | 415296 | PF3D7_0509800 | PI4K | c.4668T>C | 1.0 |
| Pf3D7_05_v3 | 959837 | PF3D7_0523000 | MDR1 | p.Asp650Asn | 0.94 |
| Pf3D7_05_v3 | 959843 | PF3D7_0523000 | MDR1 | p.Asn652Asp | 0.94 |
| Pf3D7_05_v3 | 960046 | PF3D7_0523000 | MDR1 | c.2157C>T | 1.0 |
| Pf3D7_07_v3 | 894384 | PF3D7_0720700 | PF3D7_0720700 | c.2175C>G | 1.0 |
| Pf3D7_07_v3 | 895180 | PF3D7_0720700 | PF3D7_0720700 | p.Asn991Asp | 1.0 |
| Pf3D7_07_v3 | 896099 | PF3D7_0720700 | PF3D7_0720700 | c.3890_3891insAAACAATGT | 0.78 |
| Pf3D7_07_v3 | 897236 | PF3D7_0720700 | PF3D7_0720700 | c.5028_5036delTGTAAAAAG | 1.0 |
| Pf3D7_07_v3 | 898242 | PF3D7_0720700 | PF3D7_0720700 | c.6033C>A | 1.0 |
| Pf3D7_08_v3 | 548068 | PF3D7_0810800 | PPPK-DHPS | c.-131_-130delAT | 1.0 |
| Pf3D7_08_v3 | 548801 | PF3D7_0810800 | PPPK-DHPS | c.426G>A | 1.0 |
| Pf3D7_08_v3 | 643648 | PF3D7_0813000 | PF3D7_0813000 | c.1229_1237dupATAATATGA | 0.74 |
| Pf3D7_08_v3 | 644383 | PF3D7_0813000 | PF3D7_0813000 | c.491_502delGAGATAAAGATA | 1.0 |
| Pf3D7_10_v3 | 1046204 | PF3D7_1025000 | PF3D7_1025000 | p.Arg859Lys | 1.0 |
| Pf3D7_10_v3 | 1046830 | PF3D7_1025000 | PF3D7_1025000 | c.1950A>T | 0.95 |
| Pf3D7_10_v3 | 1047084 | PF3D7_1025000 | PF3D7_1025000 | p.Asn566Asp | 1.0 |
| Pf3D7_10_v3 | 1047087 | PF3D7_1025000 | PF3D7_1025000 | p.Asn565Asp | 1.0 |
| Pf3D7_10_v3 | 1047093 | PF3D7_1025000 | PF3D7_1025000 | p.Tyr563Asp | 1.0 |
| Pf3D7_10_v3 | 1047095 | PF3D7_1025000 | PF3D7_1025000 | p.Thr562Glu | 1.0 |
| Pf3D7_10_v3 | 1047108 | PF3D7_1025000 | PF3D7_1025000 | p.Asn558Asp | 1.0 |
| Pf3D7_10_v3 | 1047111 | PF3D7_1025000 | PF3D7_1025000 | p.AsnAsn556LysTyr | 1.0 |
| Pf3D7_10_v3 | 1047113 | PF3D7_1025000 | PF3D7_1025000 | p.Asn556Thr | 1.0 |
| Pf3D7_10_v3 | 1047117 | PF3D7_1025000 | PF3D7_1025000 | p.Asp555Asn | 1.0 |
| Pf3D7_10_v3 | 1047120 | PF3D7_1025000 | PF3D7_1025000 | p.Tyr554Asn | 1.0 |
| Pf3D7_10_v3 | 1047122 | PF3D7_1025000 | PF3D7_1025000 | p.Thr553Lys | 1.0 |
| Pf3D7_10_v3 | 1047135 | PF3D7_1025000 | PF3D7_1025000 | p.Asn549Asp | 1.0 |
| Pf3D7_10_v3 | 1047138 | PF3D7_1025000 | PF3D7_1025000 | p.AsnAsn547LysTyr | 1.0 |
| Pf3D7_10_v3 | 1047140 | PF3D7_1025000 | PF3D7_1025000 | p.Asn547Thr | 1.0 |
| Pf3D7_10_v3 | 1047143 | PF3D7_1025000 | PF3D7_1025000 | c.1631_1636delCATATG | 1.0 |
| Pf3D7_10_v3 | 1047323 | PF3D7_1025000 | PF3D7_1025000 | p.Phe486Ser | 0.98 |
| Pf3D7_10_v3 | 1047779 | PF3D7_1025000 | PF3D7_1025000 | p.Gly334Glu | 1.0 |
| Pf3D7_10_v3 | 1449646 | PF3D7_1036800 | PF3D7_1036800 | p.Thr459Ile | 1.0 |
| Pf3D7_10_v3 | 1451029 | PF3D7_1036800 | PF3D7_1036800 | p.Arg104Lys | 1.0 |
| Pf3D7_11_v3 | 1526106 | PF3D7_1138700 | PF3D7_1138700 | p.Ser1721Ala | 1.0 |
| Pf3D7_11_v3 | 1528120 | PF3D7_1138700 | PF3D7_1138700 | p.Glu1049Asp | 0.96 |
| Pf3D7_11_v3 | 1529369 | PF3D7_1138700 | PF3D7_1138700 | p.Ser633Asn | 1.0 |
| Pf3D7_11_v3 | 1529778 | PF3D7_1138700 | PF3D7_1138700 | p.Glu497Gln | 1.0 |
| Pf3D7_11_v3 | 1529908 | PF3D7_1138700 | PF3D7_1138700 | c.1359T>C | 1.0 |
| Pf3D7_12_v3 | 529418 | PF3D7_1211900 | ATP4 | p.Gly1128Arg | 1.0 |
| Pf3D7_12_v3 | 529559 | PF3D7_1211900 | ATP4 | p.Gln1081Lys | 1.0 |
| Pf3D7_12_v3 | 532887 | PF3D7_1211900 | ATP4 | c.-88A>C | 0.98 |
| Pf3D7_12_v3 | 532889 | PF3D7_1211900 | ATP4 | c.-90C>A | 0.98 |
| Pf3D7_12_v3 | 592234 | PF3D7_1213800 | PRS | c.201G>A | 1.0 |
| Pf3D7_12_v3 | 592496 | PF3D7_1213800 | PRS | c.-62G>A | 1.0 |
| Pf3D7_12_v3 | 592610 | PF3D7_1213800 | PRS | c.-196_-177delAATATATATATATATATATA | 0.95 |
| Pf3D7_12_v3 | 1927229 | PF3D7_1246300 | PF3D7_1246300 | c.1041T>C | 1.0 |
| Pf3D7_12_v3 | 2092045 | PF3D7_1251200 | PF3D7_1251200 | c.-42_-41insATATAT | 1.0 |
| Pf3D7_12_v3 | 2092969 | PF3D7_1251200 | PF3D7_1251200 | p.Ser183Gly | 1.0 |
| Pf3D7_12_v3 | 2093058 | PF3D7_1251200 | PF3D7_1251200 | c.636A>G | 1.0 |
| Pf3D7_13_v3 | 1726432 | PF3D7_1343700 | K13 | p.Lys189Thr | 1.0 |
| Pf3D7_13_v3 | 1727052 | PF3D7_1343700 | K13 | c.-55A>T | 0.93 |
| Pf3D7_13_v3 | 1727056 | PF3D7_1343700 | K13 | c.-59A>T | 0.93 |
| Pf3D7_13_v3 | 1727071 | PF3D7_1343700 | K13 | c.-104_-75delAATATATATATATATATATATATATATATA | 0.93 |
| Pf3D7_14_v3 | 1550691 | PF3D7_1438400 | MCA2 | p.Asp226Glu | 1.0 |
| Pf3D7_14_v3 | 1550916 | PF3D7_1438400 | MCA2 | c.904_906delAAT | 1.0 |
| Pf3D7_14_v3 | 1553197 | PF3D7_1438400 | MCA2 | p.Glu1062Gln | 1.0 |
| Pf3D7_14_v3 | 1553266 | PF3D7_1438400 | MCA2 | p.Asn1085Asp | 1.0 |
| Pf3D7_14_v3 | 1553649 | PF3D7_1438400 | MCA2 | c.3636C>T | 1.0 |
| Pf3D7_14_v3 | 1553661 | PF3D7_1438400 | MCA2 | c.3648T>C | 1.0 |
| Pf3D7_14_v3 | 1553697 | PF3D7_1438400 | MCA2 | c.3684C>T | 1.0 |
| Pf3D7_14_v3 | 1554029 | PF3D7_1438400 | MCA2 | p.Glu1339Ala | 1.0 |
| Pf3D7_14_v3 | 1554098 | PF3D7_1438400 | MCA2 | p.Thr1362Ile | 1.0 |
| Pf3D7_14_v3 | 1554318 | PF3D7_1438400 | MCA2 | c.4305G>A | 1.0 |
| Pf3D7_14_v3 | 2090784 | PF3D7_1451100 | eEF2 | c.-118_-117insAT | 0.75 |
| Pf3D7_14_v3 | 2480289 | PF3D7_1460900 | ARPS10 | c.-151T>A | 1.0 |
| Chromosome | Position | Depth | Gene | Annotation | Drug related | Variant |
|---|
| Chromosome: | Genome Position | Locus Tag | Gene Name | Change | Estimated fraction |
|---|---|---|---|---|---|
| Pf3D7_01_v3 | 191090 | PF3D7_0104300 | UBP1 | p.Asn274Lys | 0.23 |
| Pf3D7_01_v3 | 192530 | PF3D7_0104300 | UBP1 | p.Asn754Lys | 1.0 |
| Pf3D7_01_v3 | 192533 | PF3D7_0104300 | UBP1 | c.2265A>G | 1.0 |
| Pf3D7_01_v3 | 192633 | PF3D7_0104300 | UBP1 | p.Asn789Asp | 1.0 |
| Pf3D7_01_v3 | 192640 | PF3D7_0104300 | UBP1 | c.2373_2405delCGATGATGATGACGATGACAATGATGATGATGA | 1.0 |
| Pf3D7_04_v3 | 747914 | PF3D7_0417200 | DHFR-TS | c.-174C>A | 0.17 |
| Pf3D7_04_v3 | 747993 | PF3D7_0417200 | DHFR-TS | c.-95C>A | 0.19 |
| Pf3D7_04_v3 | 747997 | PF3D7_0417200 | DHFR-TS | c.-91C>A | 0.15 |
| Pf3D7_05_v3 | 410075 | PF3D7_0509800 | PI4K | c.-193C>A | 0.15 |
| Pf3D7_05_v3 | 410184 | PF3D7_0509800 | PI4K | c.-84C>A | 0.16 |
| Pf3D7_05_v3 | 410271 | PF3D7_0509800 | PI4K | p.Glu2* | 0.1 |
| Pf3D7_05_v3 | 410566 | PF3D7_0509800 | PI4K | p.Val100Ala | 1.0 |
| Pf3D7_05_v3 | 410608 | PF3D7_0509800 | PI4K | p.Gly114Asp | 1.0 |
| Pf3D7_05_v3 | 410611 | PF3D7_0509800 | PI4K | p.Asp115Gly | 1.0 |
| Pf3D7_05_v3 | 410638 | PF3D7_0509800 | PI4K | p.Gly124Asp | 1.0 |
| Pf3D7_05_v3 | 410644 | PF3D7_0509800 | PI4K | p.Asp126Gly | 1.0 |
| Pf3D7_05_v3 | 410656 | PF3D7_0509800 | PI4K | p.Asp130Gly | 1.0 |
| Pf3D7_05_v3 | 410668 | PF3D7_0509800 | PI4K | p.Asp134Gly | 1.0 |
| Pf3D7_05_v3 | 412890 | PF3D7_0509800 | PI4K | p.Asp875Asn | 0.64 |
| Pf3D7_07_v3 | 403519 | PF3D7_0709000 | CRT | p.Leu41Ile | 0.2 |
| Pf3D7_07_v3 | 403532 | PF3D7_0709000 | CRT | p.Ala45Asp | 0.17 |
| Pf3D7_07_v3 | 403546 | PF3D7_0709000 | CRT | p.Leu50Ile | 0.13 |
| Pf3D7_07_v3 | 403621 | PF3D7_0709000 | CRT | p.Asn75Glu | 1.0 |
| Pf3D7_07_v3 | 404032 | PF3D7_0709000 | CRT | p.Thr152Asn | 0.29 |
| Pf3D7_07_v3 | 404570 | PF3D7_0709000 | CRT | c.668C>A | 0.17 |
| Pf3D7_07_v3 | 405838 | PF3D7_0709000 | CRT | p.Arg371Ile | 1.0 |
| Pf3D7_07_v3 | 892492 | PF3D7_0720700 | PF3D7_0720700 | c.285-2A>G | 0.67 |
| Pf3D7_07_v3 | 892493 | PF3D7_0720700 | PF3D7_0720700 | c.285-1G>A | 0.67 |
| Pf3D7_07_v3 | 892495 | PF3D7_0720700 | PF3D7_0720700 | c.286C>T | 0.67 |
| Pf3D7_07_v3 | 895153 | PF3D7_0720700 | PF3D7_0720700 | p.Asp982Asn | 0.2 |
| Pf3D7_07_v3 | 896100 | PF3D7_0720700 | PF3D7_0720700 | c.3891G>A | 0.1 |
| Pf3D7_08_v3 | 644936 | PF3D7_0813000 | PF3D7_0813000 | c.-51C>A | 1.0 |
| Pf3D7_08_v3 | 645031 | PF3D7_0813000 | PF3D7_0813000 | c.-147_-146insT | 1.0 |
| Pf3D7_10_v3 | 1049857 | PF3D7_1025000 | PF3D7_1025000 | c.-97G>A | 0.22 |
| Pf3D7_10_v3 | 1049903 | PF3D7_1025000 | PF3D7_1025000 | c.-145_-144delAT | 1.0 |
| Pf3D7_10_v3 | 1451758 | PF3D7_1036800 | PF3D7_1036800 | c.-112G>T | 0.14 |
| Pf3D7_10_v3 | 1451781 | PF3D7_1036800 | PF3D7_1036800 | c.-135C>A | 0.29 |
| Pf3D7_10_v3 | 1451794 | PF3D7_1036800 | PF3D7_1036800 | c.-148C>T | 0.8 |
| Pf3D7_12_v3 | 209707 | PF3D7_1204400 | PF3D7_1204400 | p.Cys166Phe | 0.2 |
| Pf3D7_12_v3 | 1925464 | PF3D7_1246300 | PF3D7_1246300 | c.-178C>A | 0.11 |
| Pf3D7_12_v3 | 1925484 | PF3D7_1246300 | PF3D7_1246300 | c.-158G>A | 1.0 |
| Pf3D7_12_v3 | 1925560 | PF3D7_1246300 | PF3D7_1246300 | c.-81_-78delTATA | 0.29 |
| Pf3D7_12_v3 | 2091948 | PF3D7_1251200 | PF3D7_1251200 | c.-139C>T | 0.16 |
| Pf3D7_12_v3 | 2091959 | PF3D7_1251200 | PF3D7_1251200 | c.-128C>T | 0.22 |
| Pf3D7_12_v3 | 2092303 | PF3D7_1251200 | PF3D7_1251200 | p.Cys25* | 0.12 |
| Pf3D7_12_v3 | 2092314 | PF3D7_1251200 | PF3D7_1251200 | p.Thr29Asn | 0.19 |
| Pf3D7_12_v3 | 2092341 | PF3D7_1251200 | PF3D7_1251200 | p.Ala38Asp | 0.14 |
| Pf3D7_12_v3 | 2092353 | PF3D7_1251200 | PF3D7_1251200 | c.125C>A | 0.12 |
| Pf3D7_13_v3 | 749141 | PF3D7_1318100 | PF3D7_1318100 | c.-170A>G | 0.11 |
| Pf3D7_13_v3 | 846960 | PF3D7_1320600 | RAB11a | c.-130G>T | 0.14 |
| Pf3D7_13_v3 | 847089 | PF3D7_1320600 | RAB11a | c.-1G>T | 0.22 |
| Pf3D7_13_v3 | 847120 | PF3D7_1320600 | RAB11a | p.Leu11Met | 0.22 |
| Pf3D7_13_v3 | 847305 | PF3D7_1320600 | RAB11a | c.43G>T | 0.13 |
| Pf3D7_14_v3 | 1548768 | PF3D7_1438400 | MCA2 | c.-150C>T | 0.25 |
| Pf3D7_14_v3 | 1548803 | PF3D7_1438400 | MCA2 | c.-115C>A | 0.31 |
| Pf3D7_14_v3 | 1550410 | PF3D7_1438400 | MCA2 | p.Met133Val | 0.31 |
| Pf3D7_14_v3 | 1550437 | PF3D7_1438400 | MCA2 | p.Met142Val | 0.31 |
| Pf3D7_14_v3 | 1550446 | PF3D7_1438400 | MCA2 | p.Val145Met | 0.31 |
| Pf3D7_14_v3 | 1550472 | PF3D7_1438400 | MCA2 | c.451_459dupGTGAATAAT | 0.29 |
| Pf3D7_14_v3 | 1550473 | PF3D7_1438400 | MCA2 | p.Met154Val | 0.13 |
| Pf3D7_14_v3 | 1550491 | PF3D7_1438400 | MCA2 | p.Val160Met | 0.13 |
| Pf3D7_14_v3 | 1550500 | PF3D7_1438400 | MCA2 | p.Met163Val | 0.13 |
| Pf3D7_14_v3 | 1551744 | PF3D7_1438400 | MCA2 | c.1731A>T | 0.22 |
| Pf3D7_14_v3 | 1551755 | PF3D7_1438400 | MCA2 | c.1743_1745delAAA | 0.22 |
| Pf3D7_14_v3 | 1553546 | PF3D7_1438400 | MCA2 | p.Ala1178Asp | 0.11 |
| Pf3D7_14_v3 | 1554043 | PF3D7_1438400 | MCA2 | p.Tyr1344Lys | 1.0 |
| Pf3D7_14_v3 | 1556509 | PF3D7_1438400 | MCA2 | p.Gly1997Glu | 0.43 |
Resistance variants report
| Gene | Mutations |
|---|---|
| MDR1 |
p.Asn86Tyr
p.Tyr184Phe
|
| CRT |
p.Met74Ile
p.Lys76Thr
p.Ala220Ser
p.Gln271Glu
|
| PPPK-DHPS |
p.Ala437Gly
|
Other variants
| Gene | ([{'chrom': 'Pf3D7_01_v3', 'pos': 190616, 'ref': 'A', 'alt': 'G', 'depth': 37, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 21, 'reverse_reads': 16, 'sv_len': None, 'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'synonymous_variant', 'change': 'c.348A>G', 'nucleotide_change': 'c.348A>G', 'protein_change': 'p.Thr116Thr', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'synonymous_variant', 'nucleotide_change': 'c.348A>G', 'protein_change': 'p.Thr116Thr', 'sequence_hgvs': 'Pf3D7_01_v3:g.190616A>G', 'annotation': [], 'gene': 'UBP1'}], 'gene': 'UBP1'}, {'chrom': 'Pf3D7_01_v3', 'pos': 190739, 'ref': 'C', 'alt': 'A', 'depth': 40, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 22, 'reverse_reads': 18, 'sv_len': None, 'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'change': 'p.Asn157Lys', 'nucleotide_change': 'c.471C>A', 'protein_change': 'p.Asn157Lys', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'nucleotide_change': 'c.471C>A', 'protein_change': 'p.Asn157Lys', 'sequence_hgvs': 'Pf3D7_01_v3:g.190739C>A', 'annotation': [], 'gene': 'UBP1'}], 'gene': 'UBP1'}, {'chrom': 'Pf3D7_01_v3', 'pos': 190967, 'ref': 'T', 'alt': 'TAATAGTATTAATAATAGTATTAAT', 'depth': 30, 'freq': 0.57, 'sv': False, 'filter': 'pass', 'forward_reads': 11, 'reverse_reads': 6, 'sv_len': None, 'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'conservative_inframe_insertion', 'change': 'c.699_700insAATAGTATTAATAATAGTATTAAT', 'nucleotide_change': 'c.699_700insAATAGTATTAATAATAGTATTAAT', 'protein_change': 'p.Asn233_Tyr234insAsnSerIleAsnAsnSerIleAsn', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'conservative_inframe_insertion', 'nucleotide_change': 'c.699_700insAATAGTATTAATAATAGTATTAAT', 'protein_change': 'p.Asn233_Tyr234insAsnSerIleAsnAsnSerIleAsn', 'sequence_hgvs': 'Pf3D7_01_v3:g.190967T>TAATAGTATTAATAATAGTATTAAT', 'annotation': [], 'gene': 'UBP1'}], 'gene': 'UBP1'}, {'chrom': 'Pf3D7_01_v3', 'pos': 191432, 'ref': 'T', 'alt': 'TGAT', 'depth': 18, 'freq': 0.83, 'sv': False, 'filter': 'pass', 'forward_reads': 6, 'reverse_reads': 9, 'sv_len': None, 'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'conservative_inframe_insertion', 'change': 'c.1162_1164dupGAT', 'nucleotide_change': 'c.1162_1164dupGAT', 'protein_change': 'p.Asp388dup', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'conservative_inframe_insertion', 'nucleotide_change': 'c.1162_1164dupGAT', 'protein_change': 'p.Asp388dup', 'sequence_hgvs': 'Pf3D7_01_v3:g.191432T>TGAT', 'annotation': [], 'gene': 'UBP1'}], 'gene': 'UBP1'}, {'chrom': 'Pf3D7_01_v3', 'pos': 192111, 'ref': 'T', 'alt': 'C', 'depth': 46, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 23, 'reverse_reads': 23, 'sv_len': None, 'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'change': 'p.Tyr615His', 'nucleotide_change': 'c.1843T>C', 'protein_change': 'p.Tyr615His', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'nucleotide_change': 'c.1843T>C', 'protein_change': 'p.Tyr615His', 'sequence_hgvs': 'Pf3D7_01_v3:g.192111T>C', 'annotation': [], 'gene': 'UBP1'}], 'gene': 'UBP1'}, {'chrom': 'Pf3D7_01_v3', 'pos': 193667, 'ref': 'G', 'alt': 'C', 'depth': 42, 'freq': 0.95, 'sv': False, 'filter': 'pass', 'forward_reads': 20, 'reverse_reads': 20, 'sv_len': None, 'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'change': 'p.Arg1133Ser', 'nucleotide_change': 'c.3399G>C', 'protein_change': 'p.Arg1133Ser', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'nucleotide_change': 'c.3399G>C', 'protein_change': 'p.Arg1133Ser', 'sequence_hgvs': 'Pf3D7_01_v3:g.193667G>C', 'annotation': [], 'gene': 'UBP1'}], 'gene': 'UBP1'}, {'chrom': 'Pf3D7_01_v3', 'pos': 194117, 'ref': 'T', 'alt': 'C', 'depth': 24, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 17, 'reverse_reads': 7, 'sv_len': None, 'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'synonymous_variant', 'change': 'c.3849T>C', 'nucleotide_change': 'c.3849T>C', 'protein_change': 'p.Phe1283Phe', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'synonymous_variant', 'nucleotide_change': 'c.3849T>C', 'protein_change': 'p.Phe1283Phe', 'sequence_hgvs': 'Pf3D7_01_v3:g.194117T>C', 'annotation': [], 'gene': 'UBP1'}], 'gene': 'UBP1'}, {'chrom': 'Pf3D7_01_v3', 'pos': 196010, 'ref': 'A', 'alt': 'C', 'depth': 35, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 22, 'reverse_reads': 13, 'sv_len': None, 'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'change': 'p.Lys1914Asn', 'nucleotide_change': 'c.5742A>C', 'protein_change': 'p.Lys1914Asn', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'nucleotide_change': 'c.5742A>C', 'protein_change': 'p.Lys1914Asn', 'sequence_hgvs': 'Pf3D7_01_v3:g.196010A>C', 'annotation': [], 'gene': 'UBP1'}], 'gene': 'UBP1'}, {'chrom': 'Pf3D7_01_v3', 'pos': 196011, 'ref': 'G', 'alt': 'A', 'depth': 35, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 22, 'reverse_reads': 13, 'sv_len': None, 'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'change': 'p.Glu1915Lys', 'nucleotide_change': 'c.5743G>A', 'protein_change': 'p.Glu1915Lys', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'nucleotide_change': 'c.5743G>A', 'protein_change': 'p.Glu1915Lys', 'sequence_hgvs': 'Pf3D7_01_v3:g.196011G>A', 'annotation': [], 'gene': 'UBP1'}], 'gene': 'UBP1'}, {'chrom': 'Pf3D7_01_v3', 'pos': 196981, 'ref': 'G', 'alt': 'A', 'depth': 49, 'freq': 0.98, 'sv': False, 'filter': 'pass', 'forward_reads': 25, 'reverse_reads': 23, 'sv_len': None, 'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'change': 'p.Arg2238Lys', 'nucleotide_change': 'c.6713G>A', 'protein_change': 'p.Arg2238Lys', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'nucleotide_change': 'c.6713G>A', 'protein_change': 'p.Arg2238Lys', 'sequence_hgvs': 'Pf3D7_01_v3:g.196981G>A', 'annotation': [], 'gene': 'UBP1'}], 'gene': 'UBP1'}, {'chrom': 'Pf3D7_01_v3', 'pos': 199865, 'ref': 'CGTATGAATCATGCAAACCGTGTGAGTC', 'alt': 'C', 'depth': 30, 'freq': 0.53, 'sv': False, 'filter': 'pass', 'forward_reads': 4, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'disruptive_inframe_deletion', 'change': 'c.9365_9391delGTATGAATCATGCAAACCGTGTGAGTC', 'nucleotide_change': 'c.9365_9391delGTATGAATCATGCAAACCGTGTGAGTC', 'protein_change': 'p.Arg3122_Ser3130del', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'disruptive_inframe_deletion', 'nucleotide_change': 'c.9365_9391delGTATGAATCATGCAAACCGTGTGAGTC', 'protein_change': 'p.Arg3122_Ser3130del', 'sequence_hgvs': 'Pf3D7_01_v3:g.199865CGTATGAATCATGCAAACCGTGTGAGTC>C', 'annotation': [], 'gene': 'UBP1'}], 'gene': 'UBP1'}, {'chrom': 'Pf3D7_01_v3', 'pos': 380532, 'ref': 'A', 'alt': 'G', 'depth': 32, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 19, 'reverse_reads': 13, 'sv_len': None, 'gene_id': 'PF3D7_0109800', 'feature_id': 'transcript:PF3D7_0109800', 'type': 'upstream_gene_variant', 'change': 'c.-165A>G', 'nucleotide_change': 'c.-165A>G', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0109800', 'feature_id': 'transcript:PF3D7_0109800', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-165A>G', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_01_v3:g.380532A>G', 'annotation': [], 'gene': 'PF3D7_0109800'}], 'gene': 'PF3D7_0109800'}, {'chrom': 'Pf3D7_01_v3', 'pos': 381402, 'ref': 'A', 'alt': 'AATA', 'depth': 34, 'freq': 0.94, 'sv': False, 'filter': 'pass', 'forward_reads': 16, 'reverse_reads': 16, 'sv_len': None, 'gene_id': 'PF3D7_0109800', 'feature_id': 'transcript:PF3D7_0109800', 'type': 'disruptive_inframe_insertion', 'change': 'c.704_706dupATA', 'nucleotide_change': 'c.704_706dupATA', 'protein_change': 'p.Asn235dup', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0109800', 'feature_id': 'transcript:PF3D7_0109800', 'type': 'disruptive_inframe_insertion', 'nucleotide_change': 'c.704_706dupATA', 'protein_change': 'p.Asn235dup', 'sequence_hgvs': 'Pf3D7_01_v3:g.381402A>AATA', 'annotation': [], 'gene': 'PF3D7_0109800'}], 'gene': 'PF3D7_0109800'}, {'chrom': 'Pf3D7_03_v3', 'pos': 922867, 'ref': 'CAT', 'alt': 'C', 'depth': 21, 'freq': 0.95, 'sv': False, 'filter': 'pass', 'forward_reads': 14, 'reverse_reads': 6, 'sv_len': None, 'gene_id': 'PF3D7_0321900', 'feature_id': 'transcript:PF3D7_0321900', 'type': 'upstream_gene_variant', 'change': 'c.-106_-105delAT', 'nucleotide_change': 'c.-106_-105delAT', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0321900', 'feature_id': 'transcript:PF3D7_0321900', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-106_-105delAT', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_03_v3:g.922867CAT>C', 'annotation': [], 'gene': 'CARL'}], 'gene': 'CARL'}, {'chrom': 'Pf3D7_03_v3', 'pos': 925808, 'ref': 'A', 'alt': 'G', 'depth': 35, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 16, 'reverse_reads': 19, 'sv_len': None, 'gene_id': 'PF3D7_0321900', 'feature_id': 'transcript:PF3D7_0321900', 'type': 'missense_variant', 'change': 'p.Lys903Glu', 'nucleotide_change': 'c.2707A>G', 'protein_change': 'p.Lys903Glu', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0321900', 'feature_id': 'transcript:PF3D7_0321900', 'type': 'missense_variant', 'nucleotide_change': 'c.2707A>G', 'protein_change': 'p.Lys903Glu', 'sequence_hgvs': 'Pf3D7_03_v3:g.925808A>G', 'annotation': [], 'gene': 'CARL'}], 'gene': 'CARL'}, {'chrom': 'Pf3D7_04_v3', 'pos': 748516, 'ref': 'T', 'alt': 'C', 'depth': 42, 'freq': 0.98, 'sv': False, 'filter': 'pass', 'forward_reads': 25, 'reverse_reads': 16, 'sv_len': None, 'gene_id': 'PF3D7_0417200', 'feature_id': 'transcript:PF3D7_0417200', 'type': 'synonymous_variant', 'change': 'c.429T>C', 'nucleotide_change': 'c.429T>C', 'protein_change': 'p.Ile143Ile', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0417200', 'feature_id': 'transcript:PF3D7_0417200', 'type': 'synonymous_variant', 'nucleotide_change': 'c.429T>C', 'protein_change': 'p.Ile143Ile', 'sequence_hgvs': 'Pf3D7_04_v3:g.748516T>C', 'annotation': [], 'gene': 'DHFR-TS'}], 'gene': 'DHFR-TS'}, {'chrom': 'Pf3D7_05_v3', 'pos': 410338, 'ref': 'A', 'alt': 'T', 'depth': 12, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 6, 'reverse_reads': 6, 'sv_len': None, 'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'missense_variant', 'change': 'p.His24Leu', 'nucleotide_change': 'c.71A>T', 'protein_change': 'p.His24Leu', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'missense_variant', 'nucleotide_change': 'c.71A>T', 'protein_change': 'p.His24Leu', 'sequence_hgvs': 'Pf3D7_05_v3:g.410338A>T', 'annotation': [], 'gene': 'PI4K'}], 'gene': 'PI4K'}, {'chrom': 'Pf3D7_05_v3', 'pos': 412895, 'ref': 'C', 'alt': 'T', 'depth': 17, 'freq': 0.76, 'sv': False, 'filter': 'pass', 'forward_reads': 6, 'reverse_reads': 7, 'sv_len': None, 'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'synonymous_variant', 'change': 'c.2628C>T', 'nucleotide_change': 'c.2628C>T', 'protein_change': 'p.Asn876Asn', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'synonymous_variant', 'nucleotide_change': 'c.2628C>T', 'protein_change': 'p.Asn876Asn', 'sequence_hgvs': 'Pf3D7_05_v3:g.412895C>T', 'annotation': [], 'gene': 'PI4K'}], 'gene': 'PI4K'}, {'chrom': 'Pf3D7_05_v3', 'pos': 412896, 'ref': 'A', 'alt': 'G', 'depth': 17, 'freq': 0.76, 'sv': False, 'filter': 'pass', 'forward_reads': 6, 'reverse_reads': 7, 'sv_len': None, 'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'missense_variant', 'change': 'p.Asn877Asp', 'nucleotide_change': 'c.2629A>G', 'protein_change': 'p.Asn877Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'missense_variant', 'nucleotide_change': 'c.2629A>G', 'protein_change': 'p.Asn877Asp', 'sequence_hgvs': 'Pf3D7_05_v3:g.412896A>G', 'annotation': [], 'gene': 'PI4K'}], 'gene': 'PI4K'}, {'chrom': 'Pf3D7_05_v3', 'pos': 413426, 'ref': 'C', 'alt': 'T', 'depth': 31, 'freq': 0.97, 'sv': False, 'filter': 'pass', 'forward_reads': 19, 'reverse_reads': 11, 'sv_len': None, 'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'synonymous_variant', 'change': 'c.3159C>T', 'nucleotide_change': 'c.3159C>T', 'protein_change': 'p.Asp1053Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'synonymous_variant', 'nucleotide_change': 'c.3159C>T', 'protein_change': 'p.Asp1053Asp', 'sequence_hgvs': 'Pf3D7_05_v3:g.413426C>T', 'annotation': [], 'gene': 'PI4K'}], 'gene': 'PI4K'}, {'chrom': 'Pf3D7_05_v3', 'pos': 413958, 'ref': 'A', 'alt': 'AATA', 'depth': 13, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 3, 'sv_len': None, 'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'disruptive_inframe_insertion', 'change': 'c.3689_3691dupATA', 'nucleotide_change': 'c.3689_3691dupATA', 'protein_change': 'p.Asn1230dup', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'disruptive_inframe_insertion', 'nucleotide_change': 'c.3689_3691dupATA', 'protein_change': 'p.Asn1230dup', 'sequence_hgvs': 'Pf3D7_05_v3:g.413958A>AATA', 'annotation': [], 'gene': 'PI4K'}], 'gene': 'PI4K'}, {'chrom': 'Pf3D7_05_v3', 'pos': 415296, 'ref': 'T', 'alt': 'C', 'depth': 20, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 8, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'synonymous_variant', 'change': 'c.4668T>C', 'nucleotide_change': 'c.4668T>C', 'protein_change': 'p.Asn1556Asn', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'synonymous_variant', 'nucleotide_change': 'c.4668T>C', 'protein_change': 'p.Asn1556Asn', 'sequence_hgvs': 'Pf3D7_05_v3:g.415296T>C', 'annotation': [], 'gene': 'PI4K'}], 'gene': 'PI4K'}, {'chrom': 'Pf3D7_05_v3', 'pos': 959837, 'ref': 'G', 'alt': 'A', 'depth': 53, 'freq': 0.94, 'sv': False, 'filter': 'pass', 'forward_reads': 21, 'reverse_reads': 29, 'sv_len': None, 'gene_id': 'PF3D7_0523000', 'feature_id': 'transcript:PF3D7_0523000', 'type': 'missense_variant', 'change': 'p.Asp650Asn', 'nucleotide_change': 'c.1948G>A', 'protein_change': 'p.Asp650Asn', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0523000', 'feature_id': 'transcript:PF3D7_0523000', 'type': 'missense_variant', 'nucleotide_change': 'c.1948G>A', 'protein_change': 'p.Asp650Asn', 'sequence_hgvs': 'Pf3D7_05_v3:g.959837G>A', 'annotation': [], 'gene': 'MDR1'}], 'gene': 'MDR1'}, {'chrom': 'Pf3D7_05_v3', 'pos': 959843, 'ref': 'A', 'alt': 'G', 'depth': 53, 'freq': 0.94, 'sv': False, 'filter': 'pass', 'forward_reads': 21, 'reverse_reads': 29, 'sv_len': None, 'gene_id': 'PF3D7_0523000', 'feature_id': 'transcript:PF3D7_0523000', 'type': 'missense_variant', 'change': 'p.Asn652Asp', 'nucleotide_change': 'c.1954A>G', 'protein_change': 'p.Asn652Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0523000', 'feature_id': 'transcript:PF3D7_0523000', 'type': 'missense_variant', 'nucleotide_change': 'c.1954A>G', 'protein_change': 'p.Asn652Asp', 'sequence_hgvs': 'Pf3D7_05_v3:g.959843A>G', 'annotation': [], 'gene': 'MDR1'}], 'gene': 'MDR1'}, {'chrom': 'Pf3D7_05_v3', 'pos': 960046, 'ref': 'C', 'alt': 'T', 'depth': 26, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 13, 'reverse_reads': 13, 'sv_len': None, 'gene_id': 'PF3D7_0523000', 'feature_id': 'transcript:PF3D7_0523000', 'type': 'synonymous_variant', 'change': 'c.2157C>T', 'nucleotide_change': 'c.2157C>T', 'protein_change': 'p.Asp719Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0523000', 'feature_id': 'transcript:PF3D7_0523000', 'type': 'synonymous_variant', 'nucleotide_change': 'c.2157C>T', 'protein_change': 'p.Asp719Asp', 'sequence_hgvs': 'Pf3D7_05_v3:g.960046C>T', 'annotation': [], 'gene': 'MDR1'}], 'gene': 'MDR1'}, {'chrom': 'Pf3D7_07_v3', 'pos': 894384, 'ref': 'C', 'alt': 'G', 'depth': 28, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 14, 'reverse_reads': 14, 'sv_len': None, 'gene_id': 'PF3D7_0720700', 'feature_id': 'transcript:PF3D7_0720700', 'type': 'synonymous_variant', 'change': 'c.2175C>G', 'nucleotide_change': 'c.2175C>G', 'protein_change': 'p.Leu725Leu', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0720700', 'feature_id': 'transcript:PF3D7_0720700', 'type': 'synonymous_variant', 'nucleotide_change': 'c.2175C>G', 'protein_change': 'p.Leu725Leu', 'sequence_hgvs': 'Pf3D7_07_v3:g.894384C>G', 'annotation': [], 'gene': 'PF3D7_0720700'}], 'gene': 'PF3D7_0720700'}, {'chrom': 'Pf3D7_07_v3', 'pos': 895180, 'ref': 'A', 'alt': 'G', 'depth': 16, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 11, 'reverse_reads': 5, 'sv_len': None, 'gene_id': 'PF3D7_0720700', 'feature_id': 'transcript:PF3D7_0720700', 'type': 'missense_variant', 'change': 'p.Asn991Asp', 'nucleotide_change': 'c.2971A>G', 'protein_change': 'p.Asn991Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0720700', 'feature_id': 'transcript:PF3D7_0720700', 'type': 'missense_variant', 'nucleotide_change': 'c.2971A>G', 'protein_change': 'p.Asn991Asp', 'sequence_hgvs': 'Pf3D7_07_v3:g.895180A>G', 'annotation': [], 'gene': 'PF3D7_0720700'}], 'gene': 'PF3D7_0720700'}, {'chrom': 'Pf3D7_07_v3', 'pos': 896099, 'ref': 'T', 'alt': 'TAAACAATGT', 'depth': 45, 'freq': 0.78, 'sv': False, 'filter': 'pass', 'forward_reads': 17, 'reverse_reads': 18, 'sv_len': None, 'gene_id': 'PF3D7_0720700', 'feature_id': 'transcript:PF3D7_0720700', 'type': 'disruptive_inframe_insertion', 'change': 'c.3890_3891insAAACAATGT', 'nucleotide_change': 'c.3890_3891insAAACAATGT', 'protein_change': 'p.Val1297_Asn1298insAsnAsnVal', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0720700', 'feature_id': 'transcript:PF3D7_0720700', 'type': 'disruptive_inframe_insertion', 'nucleotide_change': 'c.3890_3891insAAACAATGT', 'protein_change': 'p.Val1297_Asn1298insAsnAsnVal', 'sequence_hgvs': 'Pf3D7_07_v3:g.896099T>TAAACAATGT', 'annotation': [], 'gene': 'PF3D7_0720700'}], 'gene': 'PF3D7_0720700'}, {'chrom': 'Pf3D7_07_v3', 'pos': 897236, 'ref': 'GTGTAAAAAG', 'alt': 'G', 'depth': 35, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 11, 'reverse_reads': 24, 'sv_len': None, 'gene_id': 'PF3D7_0720700', 'feature_id': 'transcript:PF3D7_0720700', 'type': 'disruptive_inframe_deletion', 'change': 'c.5028_5036delTGTAAAAAG', 'nucleotide_change': 'c.5028_5036delTGTAAAAAG', 'protein_change': 'p.Val1677_Ser1679del', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0720700', 'feature_id': 'transcript:PF3D7_0720700', 'type': 'disruptive_inframe_deletion', 'nucleotide_change': 'c.5028_5036delTGTAAAAAG', 'protein_change': 'p.Val1677_Ser1679del', 'sequence_hgvs': 'Pf3D7_07_v3:g.897236GTGTAAAAAG>G', 'annotation': [], 'gene': 'PF3D7_0720700'}], 'gene': 'PF3D7_0720700'}, {'chrom': 'Pf3D7_07_v3', 'pos': 898242, 'ref': 'C', 'alt': 'A', 'depth': 11, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 5, 'reverse_reads': 6, 'sv_len': None, 'gene_id': 'PF3D7_0720700', 'feature_id': 'transcript:PF3D7_0720700', 'type': 'synonymous_variant', 'change': 'c.6033C>A', 'nucleotide_change': 'c.6033C>A', 'protein_change': 'p.Ser2011Ser', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0720700', 'feature_id': 'transcript:PF3D7_0720700', 'type': 'synonymous_variant', 'nucleotide_change': 'c.6033C>A', 'protein_change': 'p.Ser2011Ser', 'sequence_hgvs': 'Pf3D7_07_v3:g.898242C>A', 'annotation': [], 'gene': 'PF3D7_0720700'}], 'gene': 'PF3D7_0720700'}, {'chrom': 'Pf3D7_08_v3', 'pos': 548068, 'ref': 'AAT', 'alt': 'A', 'depth': 30, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 15, 'reverse_reads': 15, 'sv_len': None, 'gene_id': 'PF3D7_0810800', 'feature_id': 'transcript:PF3D7_0810800', 'type': 'upstream_gene_variant', 'change': 'c.-131_-130delAT', 'nucleotide_change': 'c.-131_-130delAT', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0810800', 'feature_id': 'transcript:PF3D7_0810800', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-131_-130delAT', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_08_v3:g.548068AAT>A', 'annotation': [], 'gene': 'PPPK-DHPS'}], 'gene': 'PPPK-DHPS'}, {'chrom': 'Pf3D7_08_v3', 'pos': 548801, 'ref': 'G', 'alt': 'A', 'depth': 27, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 17, 'reverse_reads': 10, 'sv_len': None, 'gene_id': 'PF3D7_0810800', 'feature_id': 'transcript:PF3D7_0810800', 'type': 'synonymous_variant', 'change': 'c.426G>A', 'nucleotide_change': 'c.426G>A', 'protein_change': 'p.Lys142Lys', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0810800', 'feature_id': 'transcript:PF3D7_0810800', 'type': 'synonymous_variant', 'nucleotide_change': 'c.426G>A', 'protein_change': 'p.Lys142Lys', 'sequence_hgvs': 'Pf3D7_08_v3:g.548801G>A', 'annotation': [], 'gene': 'PPPK-DHPS'}], 'gene': 'PPPK-DHPS'}, {'chrom': 'Pf3D7_08_v3', 'pos': 643648, 'ref': 'C', 'alt': 'CTCATATTAT', 'depth': 38, 'freq': 0.74, 'sv': False, 'filter': 'pass', 'forward_reads': 17, 'reverse_reads': 11, 'sv_len': None, 'gene_id': 'PF3D7_0813000', 'feature_id': 'transcript:PF3D7_0813000', 'type': 'conservative_inframe_insertion', 'change': 'c.1229_1237dupATAATATGA', 'nucleotide_change': 'c.1229_1237dupATAATATGA', 'protein_change': 'p.Asn410_Met412dup', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0813000', 'feature_id': 'transcript:PF3D7_0813000', 'type': 'conservative_inframe_insertion', 'nucleotide_change': 'c.1229_1237dupATAATATGA', 'protein_change': 'p.Asn410_Met412dup', 'sequence_hgvs': 'Pf3D7_08_v3:g.643648C>CTCATATTAT', 'annotation': [], 'gene': 'PF3D7_0813000'}], 'gene': 'PF3D7_0813000'}, {'chrom': 'Pf3D7_08_v3', 'pos': 644383, 'ref': 'TTATCTTTATCTC', 'alt': 'T', 'depth': 9, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 5, 'reverse_reads': 4, 'sv_len': None, 'gene_id': 'PF3D7_0813000', 'feature_id': 'transcript:PF3D7_0813000', 'type': 'disruptive_inframe_deletion', 'change': 'c.491_502delGAGATAAAGATA', 'nucleotide_change': 'c.491_502delGAGATAAAGATA', 'protein_change': 'p.Arg164_Asp167del', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0813000', 'feature_id': 'transcript:PF3D7_0813000', 'type': 'disruptive_inframe_deletion', 'nucleotide_change': 'c.491_502delGAGATAAAGATA', 'protein_change': 'p.Arg164_Asp167del', 'sequence_hgvs': 'Pf3D7_08_v3:g.644383TTATCTTTATCTC>T', 'annotation': [], 'gene': 'PF3D7_0813000'}], 'gene': 'PF3D7_0813000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1046204, 'ref': 'C', 'alt': 'T', 'depth': 49, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 22, 'reverse_reads': 27, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Arg859Lys', 'nucleotide_change': 'c.2576G>A', 'protein_change': 'p.Arg859Lys', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.2576G>A', 'protein_change': 'p.Arg859Lys', 'sequence_hgvs': 'Pf3D7_10_v3:g.1046204C>T', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1046830, 'ref': 'T', 'alt': 'A', 'depth': 43, 'freq': 0.95, 'sv': False, 'filter': 'pass', 'forward_reads': 20, 'reverse_reads': 21, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'synonymous_variant', 'change': 'c.1950A>T', 'nucleotide_change': 'c.1950A>T', 'protein_change': 'p.Ile650Ile', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'synonymous_variant', 'nucleotide_change': 'c.1950A>T', 'protein_change': 'p.Ile650Ile', 'sequence_hgvs': 'Pf3D7_10_v3:g.1046830T>A', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047084, 'ref': 'T', 'alt': 'C', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Asn566Asp', 'nucleotide_change': 'c.1696A>G', 'protein_change': 'p.Asn566Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1696A>G', 'protein_change': 'p.Asn566Asp', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047084T>C', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047087, 'ref': 'T', 'alt': 'C', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Asn565Asp', 'nucleotide_change': 'c.1693A>G', 'protein_change': 'p.Asn565Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1693A>G', 'protein_change': 'p.Asn565Asp', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047087T>C', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047093, 'ref': 'AT', 'alt': 'CA', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Tyr563Asp', 'nucleotide_change': 'c.1686_1687delATinsTG', 'protein_change': 'p.Tyr563Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1686_1687delATinsTG', 'protein_change': 'p.Tyr563Asp', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047093AT>CA', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047095, 'ref': 'GT', 'alt': 'TC', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Thr562Glu', 'nucleotide_change': 'c.1684_1685delACinsGA', 'protein_change': 'p.Thr562Glu', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1684_1685delACinsGA', 'protein_change': 'p.Thr562Glu', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047095GT>TC', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047108, 'ref': 'T', 'alt': 'C', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Asn558Asp', 'nucleotide_change': 'c.1672A>G', 'protein_change': 'p.Asn558Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1672A>G', 'protein_change': 'p.Asn558Asp', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047108T>C', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047111, 'ref': 'TA', 'alt': 'AT', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.AsnAsn556LysTyr', 'nucleotide_change': 'c.1668_1669delTAinsAT', 'protein_change': 'p.AsnAsn556LysTyr', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1668_1669delTAinsAT', 'protein_change': 'p.AsnAsn556LysTyr', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047111TA>AT', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047113, 'ref': 'T', 'alt': 'G', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Asn556Thr', 'nucleotide_change': 'c.1667A>C', 'protein_change': 'p.Asn556Thr', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1667A>C', 'protein_change': 'p.Asn556Thr', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047113T>G', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047117, 'ref': 'C', 'alt': 'T', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Asp555Asn', 'nucleotide_change': 'c.1663G>A', 'protein_change': 'p.Asp555Asn', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1663G>A', 'protein_change': 'p.Asp555Asn', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047117C>T', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047120, 'ref': 'AT', 'alt': 'TA', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Tyr554Asn', 'nucleotide_change': 'c.1659_1660delATinsTA', 'protein_change': 'p.Tyr554Asn', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1659_1660delATinsTA', 'protein_change': 'p.Tyr554Asn', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047120AT>TA', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047122, 'ref': 'G', 'alt': 'T', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Thr553Lys', 'nucleotide_change': 'c.1658C>A', 'protein_change': 'p.Thr553Lys', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1658C>A', 'protein_change': 'p.Thr553Lys', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047122G>T', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047135, 'ref': 'T', 'alt': 'C', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Asn549Asp', 'nucleotide_change': 'c.1645A>G', 'protein_change': 'p.Asn549Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1645A>G', 'protein_change': 'p.Asn549Asp', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047135T>C', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047138, 'ref': 'TA', 'alt': 'AT', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.AsnAsn547LysTyr', 'nucleotide_change': 'c.1641_1642delTAinsAT', 'protein_change': 'p.AsnAsn547LysTyr', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1641_1642delTAinsAT', 'protein_change': 'p.AsnAsn547LysTyr', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047138TA>AT', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047140, 'ref': 'T', 'alt': 'G', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Asn547Thr', 'nucleotide_change': 'c.1640A>C', 'protein_change': 'p.Asn547Thr', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1640A>C', 'protein_change': 'p.Asn547Thr', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047140T>G', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047143, 'ref': 'TCATATG', 'alt': 'T', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'disruptive_inframe_deletion', 'change': 'c.1631_1636delCATATG', 'nucleotide_change': 'c.1631_1636delCATATG', 'protein_change': 'p.Thr544_Asp546delinsAsn', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'disruptive_inframe_deletion', 'nucleotide_change': 'c.1631_1636delCATATG', 'protein_change': 'p.Thr544_Asp546delinsAsn', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047143TCATATG>T', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047323, 'ref': 'A', 'alt': 'G', 'depth': 48, 'freq': 0.98, 'sv': False, 'filter': 'pass', 'forward_reads': 20, 'reverse_reads': 27, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Phe486Ser', 'nucleotide_change': 'c.1457T>C', 'protein_change': 'p.Phe486Ser', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1457T>C', 'protein_change': 'p.Phe486Ser', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047323A>G', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047779, 'ref': 'C', 'alt': 'T', 'depth': 33, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 19, 'reverse_reads': 14, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Gly334Glu', 'nucleotide_change': 'c.1001G>A', 'protein_change': 'p.Gly334Glu', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1001G>A', 'protein_change': 'p.Gly334Glu', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047779C>T', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1449646, 'ref': 'G', 'alt': 'A', 'depth': 39, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 18, 'reverse_reads': 21, 'sv_len': None, 'gene_id': 'PF3D7_1036800', 'feature_id': 'transcript:PF3D7_1036800', 'type': 'missense_variant', 'change': 'p.Thr459Ile', 'nucleotide_change': 'c.1376C>T', 'protein_change': 'p.Thr459Ile', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1036800', 'feature_id': 'transcript:PF3D7_1036800', 'type': 'missense_variant', 'nucleotide_change': 'c.1376C>T', 'protein_change': 'p.Thr459Ile', 'sequence_hgvs': 'Pf3D7_10_v3:g.1449646G>A', 'annotation': [], 'gene': 'PF3D7_1036800'}], 'gene': 'PF3D7_1036800'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1451029, 'ref': 'C', 'alt': 'T', 'depth': 21, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 14, 'reverse_reads': 7, 'sv_len': None, 'gene_id': 'PF3D7_1036800', 'feature_id': 'transcript:PF3D7_1036800', 'type': 'missense_variant', 'change': 'p.Arg104Lys', 'nucleotide_change': 'c.311G>A', 'protein_change': 'p.Arg104Lys', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1036800', 'feature_id': 'transcript:PF3D7_1036800', 'type': 'missense_variant', 'nucleotide_change': 'c.311G>A', 'protein_change': 'p.Arg104Lys', 'sequence_hgvs': 'Pf3D7_10_v3:g.1451029C>T', 'annotation': [], 'gene': 'PF3D7_1036800'}], 'gene': 'PF3D7_1036800'}, {'chrom': 'Pf3D7_11_v3', 'pos': 1526106, 'ref': 'A', 'alt': 'C', 'depth': 35, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 18, 'reverse_reads': 17, 'sv_len': None, 'gene_id': 'PF3D7_1138700', 'feature_id': 'transcript:PF3D7_1138700', 'type': 'missense_variant', 'change': 'p.Ser1721Ala', 'nucleotide_change': 'c.5161T>G', 'protein_change': 'p.Ser1721Ala', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1138700', 'feature_id': 'transcript:PF3D7_1138700', 'type': 'missense_variant', 'nucleotide_change': 'c.5161T>G', 'protein_change': 'p.Ser1721Ala', 'sequence_hgvs': 'Pf3D7_11_v3:g.1526106A>C', 'annotation': [], 'gene': 'PF3D7_1138700'}], 'gene': 'PF3D7_1138700'}, {'chrom': 'Pf3D7_11_v3', 'pos': 1528120, 'ref': 'T', 'alt': 'A', 'depth': 27, 'freq': 0.96, 'sv': False, 'filter': 'pass', 'forward_reads': 11, 'reverse_reads': 15, 'sv_len': None, 'gene_id': 'PF3D7_1138700', 'feature_id': 'transcript:PF3D7_1138700', 'type': 'missense_variant', 'change': 'p.Glu1049Asp', 'nucleotide_change': 'c.3147A>T', 'protein_change': 'p.Glu1049Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1138700', 'feature_id': 'transcript:PF3D7_1138700', 'type': 'missense_variant', 'nucleotide_change': 'c.3147A>T', 'protein_change': 'p.Glu1049Asp', 'sequence_hgvs': 'Pf3D7_11_v3:g.1528120T>A', 'annotation': [], 'gene': 'PF3D7_1138700'}], 'gene': 'PF3D7_1138700'}, {'chrom': 'Pf3D7_11_v3', 'pos': 1529369, 'ref': 'C', 'alt': 'T', 'depth': 21, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 13, 'reverse_reads': 8, 'sv_len': None, 'gene_id': 'PF3D7_1138700', 'feature_id': 'transcript:PF3D7_1138700', 'type': 'missense_variant', 'change': 'p.Ser633Asn', 'nucleotide_change': 'c.1898G>A', 'protein_change': 'p.Ser633Asn', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1138700', 'feature_id': 'transcript:PF3D7_1138700', 'type': 'missense_variant', 'nucleotide_change': 'c.1898G>A', 'protein_change': 'p.Ser633Asn', 'sequence_hgvs': 'Pf3D7_11_v3:g.1529369C>T', 'annotation': [], 'gene': 'PF3D7_1138700'}], 'gene': 'PF3D7_1138700'}, {'chrom': 'Pf3D7_11_v3', 'pos': 1529778, 'ref': 'C', 'alt': 'G', 'depth': 41, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 21, 'reverse_reads': 20, 'sv_len': None, 'gene_id': 'PF3D7_1138700', 'feature_id': 'transcript:PF3D7_1138700', 'type': 'missense_variant', 'change': 'p.Glu497Gln', 'nucleotide_change': 'c.1489G>C', 'protein_change': 'p.Glu497Gln', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1138700', 'feature_id': 'transcript:PF3D7_1138700', 'type': 'missense_variant', 'nucleotide_change': 'c.1489G>C', 'protein_change': 'p.Glu497Gln', 'sequence_hgvs': 'Pf3D7_11_v3:g.1529778C>G', 'annotation': [], 'gene': 'PF3D7_1138700'}], 'gene': 'PF3D7_1138700'}, {'chrom': 'Pf3D7_11_v3', 'pos': 1529908, 'ref': 'A', 'alt': 'G', 'depth': 31, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 14, 'reverse_reads': 17, 'sv_len': None, 'gene_id': 'PF3D7_1138700', 'feature_id': 'transcript:PF3D7_1138700', 'type': 'synonymous_variant', 'change': 'c.1359T>C', 'nucleotide_change': 'c.1359T>C', 'protein_change': 'p.Asn453Asn', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1138700', 'feature_id': 'transcript:PF3D7_1138700', 'type': 'synonymous_variant', 'nucleotide_change': 'c.1359T>C', 'protein_change': 'p.Asn453Asn', 'sequence_hgvs': 'Pf3D7_11_v3:g.1529908A>G', 'annotation': [], 'gene': 'PF3D7_1138700'}], 'gene': 'PF3D7_1138700'}, {'chrom': 'Pf3D7_12_v3', 'pos': 529418, 'ref': 'C', 'alt': 'T', 'depth': 51, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 26, 'reverse_reads': 25, 'sv_len': None, 'gene_id': 'PF3D7_1211900', 'feature_id': 'transcript:PF3D7_1211900', 'type': 'missense_variant', 'change': 'p.Gly1128Arg', 'nucleotide_change': 'c.3382G>A', 'protein_change': 'p.Gly1128Arg', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1211900', 'feature_id': 'transcript:PF3D7_1211900', 'type': 'missense_variant', 'nucleotide_change': 'c.3382G>A', 'protein_change': 'p.Gly1128Arg', 'sequence_hgvs': 'Pf3D7_12_v3:g.529418C>T', 'annotation': [], 'gene': 'ATP4'}], 'gene': 'ATP4'}, {'chrom': 'Pf3D7_12_v3', 'pos': 529559, 'ref': 'G', 'alt': 'T', 'depth': 38, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 14, 'reverse_reads': 24, 'sv_len': None, 'gene_id': 'PF3D7_1211900', 'feature_id': 'transcript:PF3D7_1211900', 'type': 'missense_variant', 'change': 'p.Gln1081Lys', 'nucleotide_change': 'c.3241C>A', 'protein_change': 'p.Gln1081Lys', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1211900', 'feature_id': 'transcript:PF3D7_1211900', 'type': 'missense_variant', 'nucleotide_change': 'c.3241C>A', 'protein_change': 'p.Gln1081Lys', 'sequence_hgvs': 'Pf3D7_12_v3:g.529559G>T', 'annotation': [], 'gene': 'ATP4'}], 'gene': 'ATP4'}, {'chrom': 'Pf3D7_12_v3', 'pos': 532887, 'ref': 'T', 'alt': 'G', 'depth': 43, 'freq': 0.98, 'sv': False, 'filter': 'pass', 'forward_reads': 26, 'reverse_reads': 16, 'sv_len': None, 'gene_id': 'PF3D7_1211900', 'feature_id': 'transcript:PF3D7_1211900', 'type': 'upstream_gene_variant', 'change': 'c.-88A>C', 'nucleotide_change': 'c.-88A>C', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1211900', 'feature_id': 'transcript:PF3D7_1211900', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-88A>C', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_12_v3:g.532887T>G', 'annotation': [], 'gene': 'ATP4'}], 'gene': 'ATP4'}, {'chrom': 'Pf3D7_12_v3', 'pos': 532889, 'ref': 'G', 'alt': 'T', 'depth': 43, 'freq': 0.98, 'sv': False, 'filter': 'pass', 'forward_reads': 26, 'reverse_reads': 16, 'sv_len': None, 'gene_id': 'PF3D7_1211900', 'feature_id': 'transcript:PF3D7_1211900', 'type': 'upstream_gene_variant', 'change': 'c.-90C>A', 'nucleotide_change': 'c.-90C>A', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1211900', 'feature_id': 'transcript:PF3D7_1211900', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-90C>A', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_12_v3:g.532889G>T', 'annotation': [], 'gene': 'ATP4'}], 'gene': 'ATP4'}, {'chrom': 'Pf3D7_12_v3', 'pos': 592234, 'ref': 'C', 'alt': 'T', 'depth': 44, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 20, 'reverse_reads': 24, 'sv_len': None, 'gene_id': 'PF3D7_1213800', 'feature_id': 'transcript:PF3D7_1213800', 'type': 'synonymous_variant', 'change': 'c.201G>A', 'nucleotide_change': 'c.201G>A', 'protein_change': 'p.Lys67Lys', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1213800', 'feature_id': 'transcript:PF3D7_1213800', 'type': 'synonymous_variant', 'nucleotide_change': 'c.201G>A', 'protein_change': 'p.Lys67Lys', 'sequence_hgvs': 'Pf3D7_12_v3:g.592234C>T', 'annotation': [], 'gene': 'PRS'}], 'gene': 'PRS'}, {'chrom': 'Pf3D7_12_v3', 'pos': 592496, 'ref': 'C', 'alt': 'T', 'depth': 24, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 11, 'reverse_reads': 13, 'sv_len': None, 'gene_id': 'PF3D7_1213800', 'feature_id': 'transcript:PF3D7_1213800', 'type': 'upstream_gene_variant', 'change': 'c.-62G>A', 'nucleotide_change': 'c.-62G>A', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1213800', 'feature_id': 'transcript:PF3D7_1213800', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-62G>A', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_12_v3:g.592496C>T', 'annotation': [], 'gene': 'PRS'}], 'gene': 'PRS'}, {'chrom': 'Pf3D7_12_v3', 'pos': 592610, 'ref': 'ATATATATATATATATATATT', 'alt': 'A', 'depth': 20, 'freq': 0.95, 'sv': False, 'filter': 'pass', 'forward_reads': 8, 'reverse_reads': 11, 'sv_len': None, 'gene_id': 'PF3D7_1213800', 'feature_id': 'transcript:PF3D7_1213800', 'type': 'upstream_gene_variant', 'change': 'c.-196_-177delAATATATATATATATATATA', 'nucleotide_change': 'c.-196_-177delAATATATATATATATATATA', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1213800', 'feature_id': 'transcript:PF3D7_1213800', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-196_-177delAATATATATATATATATATA', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_12_v3:g.592610ATATATATATATATATATATT>A', 'annotation': [], 'gene': 'PRS'}], 'gene': 'PRS'}, {'chrom': 'Pf3D7_12_v3', 'pos': 1927229, 'ref': 'T', 'alt': 'C', 'depth': 30, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 20, 'reverse_reads': 10, 'sv_len': None, 'gene_id': 'PF3D7_1246300', 'feature_id': 'transcript:PF3D7_1246300', 'type': 'synonymous_variant', 'change': 'c.1041T>C', 'nucleotide_change': 'c.1041T>C', 'protein_change': 'p.Phe347Phe', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1246300', 'feature_id': 'transcript:PF3D7_1246300', 'type': 'synonymous_variant', 'nucleotide_change': 'c.1041T>C', 'protein_change': 'p.Phe347Phe', 'sequence_hgvs': 'Pf3D7_12_v3:g.1927229T>C', 'annotation': [], 'gene': 'PF3D7_1246300'}], 'gene': 'PF3D7_1246300'}, {'chrom': 'Pf3D7_12_v3', 'pos': 2092045, 'ref': 'A', 'alt': 'AATATAT', 'depth': 10, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 4, 'reverse_reads': 6, 'sv_len': None, 'gene_id': 'PF3D7_1251200', 'feature_id': 'transcript:PF3D7_1251200', 'type': 'upstream_gene_variant', 'change': 'c.-42_-41insATATAT', 'nucleotide_change': 'c.-42_-41insATATAT', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1251200', 'feature_id': 'transcript:PF3D7_1251200', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-42_-41insATATAT', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_12_v3:g.2092045A>AATATAT', 'annotation': [], 'gene': 'PF3D7_1251200'}], 'gene': 'PF3D7_1251200'}, {'chrom': 'Pf3D7_12_v3', 'pos': 2092969, 'ref': 'A', 'alt': 'G', 'depth': 17, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 7, 'reverse_reads': 10, 'sv_len': None, 'gene_id': 'PF3D7_1251200', 'feature_id': 'transcript:PF3D7_1251200', 'type': 'missense_variant', 'change': 'p.Ser183Gly', 'nucleotide_change': 'c.547A>G', 'protein_change': 'p.Ser183Gly', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1251200', 'feature_id': 'transcript:PF3D7_1251200', 'type': 'missense_variant', 'nucleotide_change': 'c.547A>G', 'protein_change': 'p.Ser183Gly', 'sequence_hgvs': 'Pf3D7_12_v3:g.2092969A>G', 'annotation': [], 'gene': 'PF3D7_1251200'}], 'gene': 'PF3D7_1251200'}, {'chrom': 'Pf3D7_12_v3', 'pos': 2093058, 'ref': 'A', 'alt': 'G', 'depth': 17, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 7, 'reverse_reads': 10, 'sv_len': None, 'gene_id': 'PF3D7_1251200', 'feature_id': 'transcript:PF3D7_1251200', 'type': 'synonymous_variant', 'change': 'c.636A>G', 'nucleotide_change': 'c.636A>G', 'protein_change': 'p.Lys212Lys', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1251200', 'feature_id': 'transcript:PF3D7_1251200', 'type': 'synonymous_variant', 'nucleotide_change': 'c.636A>G', 'protein_change': 'p.Lys212Lys', 'sequence_hgvs': 'Pf3D7_12_v3:g.2093058A>G', 'annotation': [], 'gene': 'PF3D7_1251200'}], 'gene': 'PF3D7_1251200'}, {'chrom': 'Pf3D7_13_v3', 'pos': 1726432, 'ref': 'T', 'alt': 'G', 'depth': 49, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 21, 'reverse_reads': 28, 'sv_len': None, 'gene_id': 'PF3D7_1343700', 'feature_id': 'transcript:PF3D7_1343700', 'type': 'missense_variant', 'change': 'p.Lys189Thr', 'nucleotide_change': 'c.566A>C', 'protein_change': 'p.Lys189Thr', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1343700', 'feature_id': 'transcript:PF3D7_1343700', 'type': 'missense_variant', 'nucleotide_change': 'c.566A>C', 'protein_change': 'p.Lys189Thr', 'sequence_hgvs': 'Pf3D7_13_v3:g.1726432T>G', 'annotation': [], 'gene': 'K13'}], 'gene': 'K13'}, {'chrom': 'Pf3D7_13_v3', 'pos': 1727052, 'ref': 'T', 'alt': 'A', 'depth': 15, 'freq': 0.93, 'sv': False, 'filter': 'pass', 'forward_reads': 5, 'reverse_reads': 9, 'sv_len': None, 'gene_id': 'PF3D7_1343700', 'feature_id': 'transcript:PF3D7_1343700', 'type': 'upstream_gene_variant', 'change': 'c.-55A>T', 'nucleotide_change': 'c.-55A>T', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1343700', 'feature_id': 'transcript:PF3D7_1343700', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-55A>T', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_13_v3:g.1727052T>A', 'annotation': [], 'gene': 'K13'}], 'gene': 'K13'}, {'chrom': 'Pf3D7_13_v3', 'pos': 1727056, 'ref': 'T', 'alt': 'A', 'depth': 15, 'freq': 0.93, 'sv': False, 'filter': 'pass', 'forward_reads': 5, 'reverse_reads': 9, 'sv_len': None, 'gene_id': 'PF3D7_1343700', 'feature_id': 'transcript:PF3D7_1343700', 'type': 'upstream_gene_variant', 'change': 'c.-59A>T', 'nucleotide_change': 'c.-59A>T', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1343700', 'feature_id': 'transcript:PF3D7_1343700', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-59A>T', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_13_v3:g.1727056T>A', 'annotation': [], 'gene': 'K13'}], 'gene': 'K13'}, {'chrom': 'Pf3D7_13_v3', 'pos': 1727071, 'ref': 'ATATATATATATATATATATATATATATATT', 'alt': 'A', 'depth': 15, 'freq': 0.93, 'sv': False, 'filter': 'pass', 'forward_reads': 5, 'reverse_reads': 9, 'sv_len': None, 'gene_id': 'PF3D7_1343700', 'feature_id': 'transcript:PF3D7_1343700', 'type': 'upstream_gene_variant', 'change': 'c.-104_-75delAATATATATATATATATATATATATATATA', 'nucleotide_change': 'c.-104_-75delAATATATATATATATATATATATATATATA', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1343700', 'feature_id': 'transcript:PF3D7_1343700', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-104_-75delAATATATATATATATATATATATATATATA', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_13_v3:g.1727071ATATATATATATATATATATATATATATATT>A', 'annotation': [], 'gene': 'K13'}], 'gene': 'K13'}, {'chrom': 'Pf3D7_14_v3', 'pos': 1550691, 'ref': 'T', 'alt': 'A', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 12, 'reverse_reads': 10, 'sv_len': None, 'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'missense_variant', 'change': 'p.Asp226Glu', 'nucleotide_change': 'c.678T>A', 'protein_change': 'p.Asp226Glu', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'missense_variant', 'nucleotide_change': 'c.678T>A', 'protein_change': 'p.Asp226Glu', 'sequence_hgvs': 'Pf3D7_14_v3:g.1550691T>A', 'annotation': [], 'gene': 'MCA2'}], 'gene': 'MCA2'}, {'chrom': 'Pf3D7_14_v3', 'pos': 1550916, 'ref': 'TAAT', 'alt': 'T', 'depth': 43, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 22, 'reverse_reads': 21, 'sv_len': None, 'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'conservative_inframe_deletion', 'change': 'c.904_906delAAT', 'nucleotide_change': 'c.904_906delAAT', 'protein_change': 'p.Asn302del', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'conservative_inframe_deletion', 'nucleotide_change': 'c.904_906delAAT', 'protein_change': 'p.Asn302del', 'sequence_hgvs': 'Pf3D7_14_v3:g.1550916TAAT>T', 'annotation': [], 'gene': 'MCA2'}], 'gene': 'MCA2'}, {'chrom': 'Pf3D7_14_v3', 'pos': 1553197, 'ref': 'G', 'alt': 'C', 'depth': 20, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 8, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'missense_variant', 'change': 'p.Glu1062Gln', 'nucleotide_change': 'c.3184G>C', 'protein_change': 'p.Glu1062Gln', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'missense_variant', 'nucleotide_change': 'c.3184G>C', 'protein_change': 'p.Glu1062Gln', 'sequence_hgvs': 'Pf3D7_14_v3:g.1553197G>C', 'annotation': [], 'gene': 'MCA2'}], 'gene': 'MCA2'}, {'chrom': 'Pf3D7_14_v3', 'pos': 1553266, 'ref': 'A', 'alt': 'G', 'depth': 20, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 8, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'missense_variant', 'change': 'p.Asn1085Asp', 'nucleotide_change': 'c.3253A>G', 'protein_change': 'p.Asn1085Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'missense_variant', 'nucleotide_change': 'c.3253A>G', 'protein_change': 'p.Asn1085Asp', 'sequence_hgvs': 'Pf3D7_14_v3:g.1553266A>G', 'annotation': [], 'gene': 'MCA2'}], 'gene': 'MCA2'}, {'chrom': 'Pf3D7_14_v3', 'pos': 1553649, 'ref': 'C', 'alt': 'T', 'depth': 41, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 20, 'reverse_reads': 21, 'sv_len': None, 'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'synonymous_variant', 'change': 'c.3636C>T', 'nucleotide_change': 'c.3636C>T', 'protein_change': 'p.His1212His', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'synonymous_variant', 'nucleotide_change': 'c.3636C>T', 'protein_change': 'p.His1212His', 'sequence_hgvs': 'Pf3D7_14_v3:g.1553649C>T', 'annotation': [], 'gene': 'MCA2'}], 'gene': 'MCA2'}, {'chrom': 'Pf3D7_14_v3', 'pos': 1553661, 'ref': 'T', 'alt': 'C', 'depth': 41, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 20, 'reverse_reads': 21, 'sv_len': None, 'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'synonymous_variant', 'change': 'c.3648T>C', 'nucleotide_change': 'c.3648T>C', 'protein_change': 'p.His1216His', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'synonymous_variant', 'nucleotide_change': 'c.3648T>C', 'protein_change': 'p.His1216His', 'sequence_hgvs': 'Pf3D7_14_v3:g.1553661T>C', 'annotation': [], 'gene': 'MCA2'}], 'gene': 'MCA2'}, {'chrom': 'Pf3D7_14_v3', 'pos': 1553697, 'ref': 'C', 'alt': 'T', 'depth': 41, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 20, 'reverse_reads': 21, 'sv_len': None, 'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'synonymous_variant', 'change': 'c.3684C>T', 'nucleotide_change': 'c.3684C>T', 'protein_change': 'p.His1228His', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'synonymous_variant', 'nucleotide_change': 'c.3684C>T', 'protein_change': 'p.His1228His', 'sequence_hgvs': 'Pf3D7_14_v3:g.1553697C>T', 'annotation': [], 'gene': 'MCA2'}], 'gene': 'MCA2'}, {'chrom': 'Pf3D7_14_v3', 'pos': 1554029, 'ref': 'A', 'alt': 'C', 'depth': 17, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 5, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'missense_variant', 'change': 'p.Glu1339Ala', 'nucleotide_change': 'c.4016A>C', 'protein_change': 'p.Glu1339Ala', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'missense_variant', 'nucleotide_change': 'c.4016A>C', 'protein_change': 'p.Glu1339Ala', 'sequence_hgvs': 'Pf3D7_14_v3:g.1554029A>C', 'annotation': [], 'gene': 'MCA2'}], 'gene': 'MCA2'}, {'chrom': 'Pf3D7_14_v3', 'pos': 1554098, 'ref': 'C', 'alt': 'T', 'depth': 17, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 5, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'missense_variant', 'change': 'p.Thr1362Ile', 'nucleotide_change': 'c.4085C>T', 'protein_change': 'p.Thr1362Ile', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'missense_variant', 'nucleotide_change': 'c.4085C>T', 'protein_change': 'p.Thr1362Ile', 'sequence_hgvs': 'Pf3D7_14_v3:g.1554098C>T', 'annotation': [], 'gene': 'MCA2'}], 'gene': 'MCA2'}, {'chrom': 'Pf3D7_14_v3', 'pos': 1554318, 'ref': 'G', 'alt': 'A', 'depth': 33, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 17, 'reverse_reads': 16, 'sv_len': None, 'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'synonymous_variant', 'change': 'c.4305G>A', 'nucleotide_change': 'c.4305G>A', 'protein_change': 'p.Glu1435Glu', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'synonymous_variant', 'nucleotide_change': 'c.4305G>A', 'protein_change': 'p.Glu1435Glu', 'sequence_hgvs': 'Pf3D7_14_v3:g.1554318G>A', 'annotation': [], 'gene': 'MCA2'}], 'gene': 'MCA2'}, {'chrom': 'Pf3D7_14_v3', 'pos': 2090784, 'ref': 'A', 'alt': 'AAT', 'depth': 24, 'freq': 0.75, 'sv': False, 'filter': 'pass', 'forward_reads': 8, 'reverse_reads': 10, 'sv_len': None, 'gene_id': 'PF3D7_1451100', 'feature_id': 'transcript:PF3D7_1451100', 'type': 'upstream_gene_variant', 'change': 'c.-118_-117insAT', 'nucleotide_change': 'c.-118_-117insAT', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1451100', 'feature_id': 'transcript:PF3D7_1451100', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-118_-117insAT', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_14_v3:g.2090784A>AAT', 'annotation': [], 'gene': 'eEF2'}], 'gene': 'eEF2'}, {'chrom': 'Pf3D7_14_v3', 'pos': 2480289, 'ref': 'T', 'alt': 'A', 'depth': 26, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 12, 'reverse_reads': 14, 'sv_len': None, 'gene_id': 'PF3D7_1460900', 'feature_id': 'transcript:PF3D7_1460900', 'type': 'upstream_gene_variant', 'change': 'c.-151T>A', 'nucleotide_change': 'c.-151T>A', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1460900', 'feature_id': 'transcript:PF3D7_1460900', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-151T>A', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_14_v3:g.2480289T>A', 'annotation': [], 'gene': 'ARPS10'}], 'gene': 'ARPS10'}], {'chrom': 'Chromosome:', 'pos': 'Genome Position', 'gene_id': 'Locus Tag', 'gene': 'Gene Name', 'change': 'Change', 'freq': 'Estimated fraction'}, 'Other variants', 'falciparum')Mutations |
|---|---|
| UBP1 |
c.348A>G
p.Asn157Lys
c.699_700insAATAGTATTAATAATAGTATTAAT
c.1162_1164dupGAT
p.Tyr615His
p.Arg1133Ser
c.3849T>C
p.Lys1914Asn
p.Glu1915Lys
p.Arg2238Lys
c.9365_9391delGTATGAATCATGCAAACCGTGTGAGTC
|
| PF3D7_0109800 |
c.-165A>G
c.704_706dupATA
|
| CARL |
c.-106_-105delAT
p.Lys903Glu
|
| DHFR-TS |
c.429T>C
|
| PI4K |
p.His24Leu
c.2628C>T
p.Asn877Asp
c.3159C>T
c.3689_3691dupATA
c.4668T>C
|
| MDR1 |
p.Asp650Asn
p.Asn652Asp
c.2157C>T
|
| PF3D7_0720700 |
c.2175C>G
p.Asn991Asp
c.3890_3891insAAACAATGT
c.5028_5036delTGTAAAAAG
c.6033C>A
|
| PPPK-DHPS |
c.-131_-130delAT
c.426G>A
|
| PF3D7_0813000 |
c.1229_1237dupATAATATGA
c.491_502delGAGATAAAGATA
|
| PF3D7_1025000 |
p.Arg859Lys
c.1950A>T
p.Asn566Asp
p.Asn565Asp
p.Tyr563Asp
p.Thr562Glu
p.Asn558Asp
p.AsnAsn556LysTyr
p.Asn556Thr
p.Asp555Asn
p.Tyr554Asn
p.Thr553Lys
p.Asn549Asp
p.AsnAsn547LysTyr
p.Asn547Thr
c.1631_1636delCATATG
p.Phe486Ser
p.Gly334Glu
|
| PF3D7_1036800 |
p.Thr459Ile
p.Arg104Lys
|
| PF3D7_1138700 |
p.Ser1721Ala
p.Glu1049Asp
p.Ser633Asn
p.Glu497Gln
c.1359T>C
|
| ATP4 |
p.Gly1128Arg
p.Gln1081Lys
c.-88A>C
c.-90C>A
|
| PRS |
c.201G>A
c.-62G>A
c.-196_-177delAATATATATATATATATATA
|
| PF3D7_1246300 |
c.1041T>C
|
| PF3D7_1251200 |
c.-42_-41insATATAT
p.Ser183Gly
c.636A>G
|
| K13 |
p.Lys189Thr
c.-55A>T
c.-59A>T
c.-104_-75delAATATATATATATATATATATATATATATA
|
| MCA2 |
p.Asp226Glu
c.904_906delAAT
p.Glu1062Gln
p.Asn1085Asp
c.3636C>T
c.3648T>C
c.3684C>T
p.Glu1339Ala
p.Thr1362Ile
c.4305G>A
|
| eEF2 |
c.-118_-117insAT
|
| ARPS10 |
c.-151T>A
|
QC failed variants
| Gene | Mutations |
|---|---|
| UBP1 |
|
| DHFR-TS |
|
| PI4K |
|
| CRT |
|
| PF3D7_0720700 |
|
| PF3D7_0813000 |
|
| PF3D7_1025000 |
|
| PF3D7_1036800 |
|
| PF3D7_1204400 |
|
| PF3D7_1246300 |
|
| PF3D7_1251200 |
|
| PF3D7_1318100 |
|
| RAB11a |
|
| MCA2 |
|
Missing positions report
| Gene | Mutations |
|---|
Western Africa - 100.0%
Percentage of barcoding SNPs that have coverage: 100.0 %
| Process | Software |
|---|---|
| Software | {'taxonomic_software': 'sourmash', 'trimming': 'trimmomatic', 'mapping': 'bwa', 'variant_calling': 'freebayes-Haplotype', 'depth_calculation': 'samtools'} |
This section shows the average number of reads that align to, or 'cover', known reference bases
Next| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| UBP1 | 99.92 | 40.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| PF3D7_0109800 | 100.0 | 38.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| CARL | 100.0 | 33.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| DHFR-TS | 100.0 | 43.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| PI4K | 100.0 | 39.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| MDR1 | 100.0 | 39.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| DHODH | 100.0 | 43.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| CRT | 99.48 | 24.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| PF3D7_0720700 | 100.0 | 40.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| PPPK-DHPS | 100.0 | 39.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| PF3D7_0813000 | 100.0 | 38.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| PF3D7_1025000 | 99.91 | 43.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| PF3D7_1036800 | 100.0 | 35.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| PF3D7_1113300 | 100.0 | 32.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| PF3D7_1138700 | 100.0 | 42.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| PF3D7_1204400 | 100.0 | 27.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| ATP4 | 100.0 | 45.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| PRS | 100.0 | 40.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| AP2-MU | 100.0 | 34.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| PF3D7_1246300 | 100.0 | 31.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| PF3D7_1251200 | 100.0 | 36.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| PF3D7_1318100 | 100.0 | 33.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| RAB11a | 100.0 | 26.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| K13 | 100.0 | 42.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| MCA2 | 100.0 | 37.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| eEF2 | 100.0 | 43.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| ARPS10 | 100.0 | 29.0 |
| Gene | Percentage Depth passed | Median Depth |
|---|---|---|
| CYTB | 100.0 | 960.0 |
| Gene | Percentage depth passed | Median Depth |
|---|---|---|
| UBP1 | 99.92 | 40.0 |
| PF3D7_0109800 | 100.0 | 38.0 |
| CARL | 100.0 | 33.0 |
| DHFR-TS | 100.0 | 43.0 |
| PI4K | 100.0 | 39.0 |
| MDR1 | 100.0 | 39.0 |
| DHODH | 100.0 | 43.0 |
| CRT | 99.48 | 24.0 |
| PF3D7_0720700 | 100.0 | 40.0 |
| PPPK-DHPS | 100.0 | 39.0 |
| PF3D7_0813000 | 100.0 | 38.0 |
| PF3D7_1025000 | 99.91 | 43.0 |
| PF3D7_1036800 | 100.0 | 35.0 |
| PF3D7_1113300 | 100.0 | 32.0 |
| PF3D7_1138700 | 100.0 | 42.0 |
| PF3D7_1204400 | 100.0 | 27.0 |
| ATP4 | 100.0 | 45.0 |
| PRS | 100.0 | 40.0 |
| AP2-MU | 100.0 | 34.0 |
| PF3D7_1246300 | 100.0 | 31.0 |
| PF3D7_1251200 | 100.0 | 36.0 |
| PF3D7_1318100 | 100.0 | 33.0 |
| RAB11a | 100.0 | 26.0 |
| K13 | 100.0 | 42.0 |
| MCA2 | 100.0 | 37.0 |
| eEF2 | 100.0 | 43.0 |
| ARPS10 | 100.0 | 29.0 |
| CYTB | 100.0 | 960.0 |
| Identifier | Date |
|---|---|
| Err1008804 | Fri May 1 08:41:38 2026 |
| Species | ANI | Abundance | Accession |
|---|---|---|---|
Plasmodium falciparum |
99.8 % |
35.68 |
Plasmodium_falciparum |
| Drug | Mutations |
|---|---|
|
Chloroquine |
MDR1 p.Asn86Tyr (1.00) , MDR1 p.Tyr184Phe (1.00) , CRT p.Met74Ile (1.00) , CRT p.Lys76Thr (1.00) , CRT p.Ala220Ser (1.00) , CRT p.Gln271Glu (1.00) |
|
Mefloquine |
|
|
Pyrimethamine |
|
|
Sulfadoxine |
PPPK-DHPS p.Ala437Gly (0.97) |
|
Artemisinin |
| Chromosome: | Genome Position | Locus Tag | Gene Name | Change | Estimated fraction |
|---|---|---|---|---|---|
| Pf3D7_01_v3 | 190616 | PF3D7_0104300 | UBP1 | c.348A>G | 1.0 |
| Pf3D7_01_v3 | 190739 | PF3D7_0104300 | UBP1 | p.Asn157Lys | 1.0 |
| Pf3D7_01_v3 | 190967 | PF3D7_0104300 | UBP1 | c.699_700insAATAGTATTAATAATAGTATTAAT | 0.57 |
| Pf3D7_01_v3 | 191432 | PF3D7_0104300 | UBP1 | c.1162_1164dupGAT | 0.83 |
| Pf3D7_01_v3 | 192111 | PF3D7_0104300 | UBP1 | p.Tyr615His | 1.0 |
| Pf3D7_01_v3 | 193667 | PF3D7_0104300 | UBP1 | p.Arg1133Ser | 0.95 |
| Pf3D7_01_v3 | 194117 | PF3D7_0104300 | UBP1 | c.3849T>C | 1.0 |
| Pf3D7_01_v3 | 196010 | PF3D7_0104300 | UBP1 | p.Lys1914Asn | 1.0 |
| Pf3D7_01_v3 | 196011 | PF3D7_0104300 | UBP1 | p.Glu1915Lys | 1.0 |
| Pf3D7_01_v3 | 196981 | PF3D7_0104300 | UBP1 | p.Arg2238Lys | 0.98 |
| Pf3D7_01_v3 | 199865 | PF3D7_0104300 | UBP1 | c.9365_9391delGTATGAATCATGCAAACCGTGTGAGTC | 0.53 |
| Pf3D7_01_v3 | 380532 | PF3D7_0109800 | PF3D7_0109800 | c.-165A>G | 1.0 |
| Pf3D7_01_v3 | 381402 | PF3D7_0109800 | PF3D7_0109800 | c.704_706dupATA | 0.94 |
| Pf3D7_03_v3 | 922867 | PF3D7_0321900 | CARL | c.-106_-105delAT | 0.95 |
| Pf3D7_03_v3 | 925808 | PF3D7_0321900 | CARL | p.Lys903Glu | 1.0 |
| Pf3D7_04_v3 | 748516 | PF3D7_0417200 | DHFR-TS | c.429T>C | 0.98 |
| Pf3D7_05_v3 | 410338 | PF3D7_0509800 | PI4K | p.His24Leu | 1.0 |
| Pf3D7_05_v3 | 412895 | PF3D7_0509800 | PI4K | c.2628C>T | 0.76 |
| Pf3D7_05_v3 | 412896 | PF3D7_0509800 | PI4K | p.Asn877Asp | 0.76 |
| Pf3D7_05_v3 | 413426 | PF3D7_0509800 | PI4K | c.3159C>T | 0.97 |
| Pf3D7_05_v3 | 413958 | PF3D7_0509800 | PI4K | c.3689_3691dupATA | 1.0 |
| Pf3D7_05_v3 | 415296 | PF3D7_0509800 | PI4K | c.4668T>C | 1.0 |
| Pf3D7_05_v3 | 959837 | PF3D7_0523000 | MDR1 | p.Asp650Asn | 0.94 |
| Pf3D7_05_v3 | 959843 | PF3D7_0523000 | MDR1 | p.Asn652Asp | 0.94 |
| Pf3D7_05_v3 | 960046 | PF3D7_0523000 | MDR1 | c.2157C>T | 1.0 |
| Pf3D7_07_v3 | 894384 | PF3D7_0720700 | PF3D7_0720700 | c.2175C>G | 1.0 |
| Pf3D7_07_v3 | 895180 | PF3D7_0720700 | PF3D7_0720700 | p.Asn991Asp | 1.0 |
| Pf3D7_07_v3 | 896099 | PF3D7_0720700 | PF3D7_0720700 | c.3890_3891insAAACAATGT | 0.78 |
| Pf3D7_07_v3 | 897236 | PF3D7_0720700 | PF3D7_0720700 | c.5028_5036delTGTAAAAAG | 1.0 |
| Pf3D7_07_v3 | 898242 | PF3D7_0720700 | PF3D7_0720700 | c.6033C>A | 1.0 |
| Pf3D7_08_v3 | 548068 | PF3D7_0810800 | PPPK-DHPS | c.-131_-130delAT | 1.0 |
| Pf3D7_08_v3 | 548801 | PF3D7_0810800 | PPPK-DHPS | c.426G>A | 1.0 |
| Pf3D7_08_v3 | 643648 | PF3D7_0813000 | PF3D7_0813000 | c.1229_1237dupATAATATGA | 0.74 |
| Pf3D7_08_v3 | 644383 | PF3D7_0813000 | PF3D7_0813000 | c.491_502delGAGATAAAGATA | 1.0 |
| Pf3D7_10_v3 | 1046204 | PF3D7_1025000 | PF3D7_1025000 | p.Arg859Lys | 1.0 |
| Pf3D7_10_v3 | 1046830 | PF3D7_1025000 | PF3D7_1025000 | c.1950A>T | 0.95 |
| Pf3D7_10_v3 | 1047084 | PF3D7_1025000 | PF3D7_1025000 | p.Asn566Asp | 1.0 |
| Pf3D7_10_v3 | 1047087 | PF3D7_1025000 | PF3D7_1025000 | p.Asn565Asp | 1.0 |
| Pf3D7_10_v3 | 1047093 | PF3D7_1025000 | PF3D7_1025000 | p.Tyr563Asp | 1.0 |
| Pf3D7_10_v3 | 1047095 | PF3D7_1025000 | PF3D7_1025000 | p.Thr562Glu | 1.0 |
| Pf3D7_10_v3 | 1047108 | PF3D7_1025000 | PF3D7_1025000 | p.Asn558Asp | 1.0 |
| Pf3D7_10_v3 | 1047111 | PF3D7_1025000 | PF3D7_1025000 | p.AsnAsn556LysTyr | 1.0 |
| Pf3D7_10_v3 | 1047113 | PF3D7_1025000 | PF3D7_1025000 | p.Asn556Thr | 1.0 |
| Pf3D7_10_v3 | 1047117 | PF3D7_1025000 | PF3D7_1025000 | p.Asp555Asn | 1.0 |
| Pf3D7_10_v3 | 1047120 | PF3D7_1025000 | PF3D7_1025000 | p.Tyr554Asn | 1.0 |
| Pf3D7_10_v3 | 1047122 | PF3D7_1025000 | PF3D7_1025000 | p.Thr553Lys | 1.0 |
| Pf3D7_10_v3 | 1047135 | PF3D7_1025000 | PF3D7_1025000 | p.Asn549Asp | 1.0 |
| Pf3D7_10_v3 | 1047138 | PF3D7_1025000 | PF3D7_1025000 | p.AsnAsn547LysTyr | 1.0 |
| Pf3D7_10_v3 | 1047140 | PF3D7_1025000 | PF3D7_1025000 | p.Asn547Thr | 1.0 |
| Pf3D7_10_v3 | 1047143 | PF3D7_1025000 | PF3D7_1025000 | c.1631_1636delCATATG | 1.0 |
| Pf3D7_10_v3 | 1047323 | PF3D7_1025000 | PF3D7_1025000 | p.Phe486Ser | 0.98 |
| Pf3D7_10_v3 | 1047779 | PF3D7_1025000 | PF3D7_1025000 | p.Gly334Glu | 1.0 |
| Pf3D7_10_v3 | 1449646 | PF3D7_1036800 | PF3D7_1036800 | p.Thr459Ile | 1.0 |
| Pf3D7_10_v3 | 1451029 | PF3D7_1036800 | PF3D7_1036800 | p.Arg104Lys | 1.0 |
| Pf3D7_11_v3 | 1526106 | PF3D7_1138700 | PF3D7_1138700 | p.Ser1721Ala | 1.0 |
| Pf3D7_11_v3 | 1528120 | PF3D7_1138700 | PF3D7_1138700 | p.Glu1049Asp | 0.96 |
| Pf3D7_11_v3 | 1529369 | PF3D7_1138700 | PF3D7_1138700 | p.Ser633Asn | 1.0 |
| Pf3D7_11_v3 | 1529778 | PF3D7_1138700 | PF3D7_1138700 | p.Glu497Gln | 1.0 |
| Pf3D7_11_v3 | 1529908 | PF3D7_1138700 | PF3D7_1138700 | c.1359T>C | 1.0 |
| Pf3D7_12_v3 | 529418 | PF3D7_1211900 | ATP4 | p.Gly1128Arg | 1.0 |
| Pf3D7_12_v3 | 529559 | PF3D7_1211900 | ATP4 | p.Gln1081Lys | 1.0 |
| Pf3D7_12_v3 | 532887 | PF3D7_1211900 | ATP4 | c.-88A>C | 0.98 |
| Pf3D7_12_v3 | 532889 | PF3D7_1211900 | ATP4 | c.-90C>A | 0.98 |
| Pf3D7_12_v3 | 592234 | PF3D7_1213800 | PRS | c.201G>A | 1.0 |
| Pf3D7_12_v3 | 592496 | PF3D7_1213800 | PRS | c.-62G>A | 1.0 |
| Pf3D7_12_v3 | 592610 | PF3D7_1213800 | PRS | c.-196_-177delAATATATATATATATATATA | 0.95 |
| Pf3D7_12_v3 | 1927229 | PF3D7_1246300 | PF3D7_1246300 | c.1041T>C | 1.0 |
| Pf3D7_12_v3 | 2092045 | PF3D7_1251200 | PF3D7_1251200 | c.-42_-41insATATAT | 1.0 |
| Pf3D7_12_v3 | 2092969 | PF3D7_1251200 | PF3D7_1251200 | p.Ser183Gly | 1.0 |
| Pf3D7_12_v3 | 2093058 | PF3D7_1251200 | PF3D7_1251200 | c.636A>G | 1.0 |
| Pf3D7_13_v3 | 1726432 | PF3D7_1343700 | K13 | p.Lys189Thr | 1.0 |
| Pf3D7_13_v3 | 1727052 | PF3D7_1343700 | K13 | c.-55A>T | 0.93 |
| Pf3D7_13_v3 | 1727056 | PF3D7_1343700 | K13 | c.-59A>T | 0.93 |
| Pf3D7_13_v3 | 1727071 | PF3D7_1343700 | K13 | c.-104_-75delAATATATATATATATATATATATATATATA | 0.93 |
| Pf3D7_14_v3 | 1550691 | PF3D7_1438400 | MCA2 | p.Asp226Glu | 1.0 |
| Pf3D7_14_v3 | 1550916 | PF3D7_1438400 | MCA2 | c.904_906delAAT | 1.0 |
| Pf3D7_14_v3 | 1553197 | PF3D7_1438400 | MCA2 | p.Glu1062Gln | 1.0 |
| Pf3D7_14_v3 | 1553266 | PF3D7_1438400 | MCA2 | p.Asn1085Asp | 1.0 |
| Pf3D7_14_v3 | 1553649 | PF3D7_1438400 | MCA2 | c.3636C>T | 1.0 |
| Pf3D7_14_v3 | 1553661 | PF3D7_1438400 | MCA2 | c.3648T>C | 1.0 |
| Pf3D7_14_v3 | 1553697 | PF3D7_1438400 | MCA2 | c.3684C>T | 1.0 |
| Pf3D7_14_v3 | 1554029 | PF3D7_1438400 | MCA2 | p.Glu1339Ala | 1.0 |
| Pf3D7_14_v3 | 1554098 | PF3D7_1438400 | MCA2 | p.Thr1362Ile | 1.0 |
| Pf3D7_14_v3 | 1554318 | PF3D7_1438400 | MCA2 | c.4305G>A | 1.0 |
| Pf3D7_14_v3 | 2090784 | PF3D7_1451100 | eEF2 | c.-118_-117insAT | 0.75 |
| Pf3D7_14_v3 | 2480289 | PF3D7_1460900 | ARPS10 | c.-151T>A | 1.0 |
| Chromosome: | Genome Position | Locus Tag | Gene Name | Change | Estimated fraction |
|---|---|---|---|---|---|
| Pf3D7_01_v3 | 191090 | PF3D7_0104300 | UBP1 | p.Asn274Lys | 0.23 |
| Pf3D7_01_v3 | 192530 | PF3D7_0104300 | UBP1 | p.Asn754Lys | 1.0 |
| Pf3D7_01_v3 | 192533 | PF3D7_0104300 | UBP1 | c.2265A>G | 1.0 |
| Pf3D7_01_v3 | 192633 | PF3D7_0104300 | UBP1 | p.Asn789Asp | 1.0 |
| Pf3D7_01_v3 | 192640 | PF3D7_0104300 | UBP1 | c.2373_2405delCGATGATGATGACGATGACAATGATGATGATGA | 1.0 |
| Pf3D7_04_v3 | 747914 | PF3D7_0417200 | DHFR-TS | c.-174C>A | 0.17 |
| Pf3D7_04_v3 | 747993 | PF3D7_0417200 | DHFR-TS | c.-95C>A | 0.19 |
| Pf3D7_04_v3 | 747997 | PF3D7_0417200 | DHFR-TS | c.-91C>A | 0.15 |
| Pf3D7_05_v3 | 410075 | PF3D7_0509800 | PI4K | c.-193C>A | 0.15 |
| Pf3D7_05_v3 | 410184 | PF3D7_0509800 | PI4K | c.-84C>A | 0.16 |
| Pf3D7_05_v3 | 410271 | PF3D7_0509800 | PI4K | p.Glu2* | 0.1 |
| Pf3D7_05_v3 | 410566 | PF3D7_0509800 | PI4K | p.Val100Ala | 1.0 |
| Pf3D7_05_v3 | 410608 | PF3D7_0509800 | PI4K | p.Gly114Asp | 1.0 |
| Pf3D7_05_v3 | 410611 | PF3D7_0509800 | PI4K | p.Asp115Gly | 1.0 |
| Pf3D7_05_v3 | 410638 | PF3D7_0509800 | PI4K | p.Gly124Asp | 1.0 |
| Pf3D7_05_v3 | 410644 | PF3D7_0509800 | PI4K | p.Asp126Gly | 1.0 |
| Pf3D7_05_v3 | 410656 | PF3D7_0509800 | PI4K | p.Asp130Gly | 1.0 |
| Pf3D7_05_v3 | 410668 | PF3D7_0509800 | PI4K | p.Asp134Gly | 1.0 |
| Pf3D7_05_v3 | 412890 | PF3D7_0509800 | PI4K | p.Asp875Asn | 0.64 |
| Pf3D7_07_v3 | 403519 | PF3D7_0709000 | CRT | p.Leu41Ile | 0.2 |
| Pf3D7_07_v3 | 403532 | PF3D7_0709000 | CRT | p.Ala45Asp | 0.17 |
| Pf3D7_07_v3 | 403546 | PF3D7_0709000 | CRT | p.Leu50Ile | 0.13 |
| Pf3D7_07_v3 | 403621 | PF3D7_0709000 | CRT | p.Asn75Glu | 1.0 |
| Pf3D7_07_v3 | 404032 | PF3D7_0709000 | CRT | p.Thr152Asn | 0.29 |
| Pf3D7_07_v3 | 404570 | PF3D7_0709000 | CRT | c.668C>A | 0.17 |
| Pf3D7_07_v3 | 405838 | PF3D7_0709000 | CRT | p.Arg371Ile | 1.0 |
| Pf3D7_07_v3 | 892492 | PF3D7_0720700 | PF3D7_0720700 | c.285-2A>G | 0.67 |
| Pf3D7_07_v3 | 892493 | PF3D7_0720700 | PF3D7_0720700 | c.285-1G>A | 0.67 |
| Pf3D7_07_v3 | 892495 | PF3D7_0720700 | PF3D7_0720700 | c.286C>T | 0.67 |
| Pf3D7_07_v3 | 895153 | PF3D7_0720700 | PF3D7_0720700 | p.Asp982Asn | 0.2 |
| Pf3D7_07_v3 | 896100 | PF3D7_0720700 | PF3D7_0720700 | c.3891G>A | 0.1 |
| Pf3D7_08_v3 | 644936 | PF3D7_0813000 | PF3D7_0813000 | c.-51C>A | 1.0 |
| Pf3D7_08_v3 | 645031 | PF3D7_0813000 | PF3D7_0813000 | c.-147_-146insT | 1.0 |
| Pf3D7_10_v3 | 1049857 | PF3D7_1025000 | PF3D7_1025000 | c.-97G>A | 0.22 |
| Pf3D7_10_v3 | 1049903 | PF3D7_1025000 | PF3D7_1025000 | c.-145_-144delAT | 1.0 |
| Pf3D7_10_v3 | 1451758 | PF3D7_1036800 | PF3D7_1036800 | c.-112G>T | 0.14 |
| Pf3D7_10_v3 | 1451781 | PF3D7_1036800 | PF3D7_1036800 | c.-135C>A | 0.29 |
| Pf3D7_10_v3 | 1451794 | PF3D7_1036800 | PF3D7_1036800 | c.-148C>T | 0.8 |
| Pf3D7_12_v3 | 209707 | PF3D7_1204400 | PF3D7_1204400 | p.Cys166Phe | 0.2 |
| Pf3D7_12_v3 | 1925464 | PF3D7_1246300 | PF3D7_1246300 | c.-178C>A | 0.11 |
| Pf3D7_12_v3 | 1925484 | PF3D7_1246300 | PF3D7_1246300 | c.-158G>A | 1.0 |
| Pf3D7_12_v3 | 1925560 | PF3D7_1246300 | PF3D7_1246300 | c.-81_-78delTATA | 0.29 |
| Pf3D7_12_v3 | 2091948 | PF3D7_1251200 | PF3D7_1251200 | c.-139C>T | 0.16 |
| Pf3D7_12_v3 | 2091959 | PF3D7_1251200 | PF3D7_1251200 | c.-128C>T | 0.22 |
| Pf3D7_12_v3 | 2092303 | PF3D7_1251200 | PF3D7_1251200 | p.Cys25* | 0.12 |
| Pf3D7_12_v3 | 2092314 | PF3D7_1251200 | PF3D7_1251200 | p.Thr29Asn | 0.19 |
| Pf3D7_12_v3 | 2092341 | PF3D7_1251200 | PF3D7_1251200 | p.Ala38Asp | 0.14 |
| Pf3D7_12_v3 | 2092353 | PF3D7_1251200 | PF3D7_1251200 | c.125C>A | 0.12 |
| Pf3D7_13_v3 | 749141 | PF3D7_1318100 | PF3D7_1318100 | c.-170A>G | 0.11 |
| Pf3D7_13_v3 | 846960 | PF3D7_1320600 | RAB11a | c.-130G>T | 0.14 |
| Pf3D7_13_v3 | 847089 | PF3D7_1320600 | RAB11a | c.-1G>T | 0.22 |
| Pf3D7_13_v3 | 847120 | PF3D7_1320600 | RAB11a | p.Leu11Met | 0.22 |
| Pf3D7_13_v3 | 847305 | PF3D7_1320600 | RAB11a | c.43G>T | 0.13 |
| Pf3D7_14_v3 | 1548768 | PF3D7_1438400 | MCA2 | c.-150C>T | 0.25 |
| Pf3D7_14_v3 | 1548803 | PF3D7_1438400 | MCA2 | c.-115C>A | 0.31 |
| Pf3D7_14_v3 | 1550410 | PF3D7_1438400 | MCA2 | p.Met133Val | 0.31 |
| Pf3D7_14_v3 | 1550437 | PF3D7_1438400 | MCA2 | p.Met142Val | 0.31 |
| Pf3D7_14_v3 | 1550446 | PF3D7_1438400 | MCA2 | p.Val145Met | 0.31 |
| Pf3D7_14_v3 | 1550472 | PF3D7_1438400 | MCA2 | c.451_459dupGTGAATAAT | 0.29 |
| Pf3D7_14_v3 | 1550473 | PF3D7_1438400 | MCA2 | p.Met154Val | 0.13 |
| Pf3D7_14_v3 | 1550491 | PF3D7_1438400 | MCA2 | p.Val160Met | 0.13 |
| Pf3D7_14_v3 | 1550500 | PF3D7_1438400 | MCA2 | p.Met163Val | 0.13 |
| Pf3D7_14_v3 | 1551744 | PF3D7_1438400 | MCA2 | c.1731A>T | 0.22 |
| Pf3D7_14_v3 | 1551755 | PF3D7_1438400 | MCA2 | c.1743_1745delAAA | 0.22 |
| Pf3D7_14_v3 | 1553546 | PF3D7_1438400 | MCA2 | p.Ala1178Asp | 0.11 |
| Pf3D7_14_v3 | 1554043 | PF3D7_1438400 | MCA2 | p.Tyr1344Lys | 1.0 |
| Pf3D7_14_v3 | 1556509 | PF3D7_1438400 | MCA2 | p.Gly1997Glu | 0.43 |
| Chromosome | Position | Depth | Gene | Annotation | Drug related | Variant |
|---|
Resistance variants report
| Gene | Mutations |
|---|---|
| MDR1 |
p.Asn86Tyr
p.Tyr184Phe
|
| CRT |
p.Met74Ile
p.Lys76Thr
p.Ala220Ser
p.Gln271Glu
|
| PPPK-DHPS |
p.Ala437Gly
|
Other variants
| Gene | ([{'chrom': 'Pf3D7_01_v3', 'pos': 190616, 'ref': 'A', 'alt': 'G', 'depth': 37, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 21, 'reverse_reads': 16, 'sv_len': None, 'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'synonymous_variant', 'change': 'c.348A>G', 'nucleotide_change': 'c.348A>G', 'protein_change': 'p.Thr116Thr', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'synonymous_variant', 'nucleotide_change': 'c.348A>G', 'protein_change': 'p.Thr116Thr', 'sequence_hgvs': 'Pf3D7_01_v3:g.190616A>G', 'annotation': [], 'gene': 'UBP1'}], 'gene': 'UBP1'}, {'chrom': 'Pf3D7_01_v3', 'pos': 190739, 'ref': 'C', 'alt': 'A', 'depth': 40, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 22, 'reverse_reads': 18, 'sv_len': None, 'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'change': 'p.Asn157Lys', 'nucleotide_change': 'c.471C>A', 'protein_change': 'p.Asn157Lys', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'nucleotide_change': 'c.471C>A', 'protein_change': 'p.Asn157Lys', 'sequence_hgvs': 'Pf3D7_01_v3:g.190739C>A', 'annotation': [], 'gene': 'UBP1'}], 'gene': 'UBP1'}, {'chrom': 'Pf3D7_01_v3', 'pos': 190967, 'ref': 'T', 'alt': 'TAATAGTATTAATAATAGTATTAAT', 'depth': 30, 'freq': 0.57, 'sv': False, 'filter': 'pass', 'forward_reads': 11, 'reverse_reads': 6, 'sv_len': None, 'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'conservative_inframe_insertion', 'change': 'c.699_700insAATAGTATTAATAATAGTATTAAT', 'nucleotide_change': 'c.699_700insAATAGTATTAATAATAGTATTAAT', 'protein_change': 'p.Asn233_Tyr234insAsnSerIleAsnAsnSerIleAsn', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'conservative_inframe_insertion', 'nucleotide_change': 'c.699_700insAATAGTATTAATAATAGTATTAAT', 'protein_change': 'p.Asn233_Tyr234insAsnSerIleAsnAsnSerIleAsn', 'sequence_hgvs': 'Pf3D7_01_v3:g.190967T>TAATAGTATTAATAATAGTATTAAT', 'annotation': [], 'gene': 'UBP1'}], 'gene': 'UBP1'}, {'chrom': 'Pf3D7_01_v3', 'pos': 191432, 'ref': 'T', 'alt': 'TGAT', 'depth': 18, 'freq': 0.83, 'sv': False, 'filter': 'pass', 'forward_reads': 6, 'reverse_reads': 9, 'sv_len': None, 'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'conservative_inframe_insertion', 'change': 'c.1162_1164dupGAT', 'nucleotide_change': 'c.1162_1164dupGAT', 'protein_change': 'p.Asp388dup', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'conservative_inframe_insertion', 'nucleotide_change': 'c.1162_1164dupGAT', 'protein_change': 'p.Asp388dup', 'sequence_hgvs': 'Pf3D7_01_v3:g.191432T>TGAT', 'annotation': [], 'gene': 'UBP1'}], 'gene': 'UBP1'}, {'chrom': 'Pf3D7_01_v3', 'pos': 192111, 'ref': 'T', 'alt': 'C', 'depth': 46, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 23, 'reverse_reads': 23, 'sv_len': None, 'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'change': 'p.Tyr615His', 'nucleotide_change': 'c.1843T>C', 'protein_change': 'p.Tyr615His', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'nucleotide_change': 'c.1843T>C', 'protein_change': 'p.Tyr615His', 'sequence_hgvs': 'Pf3D7_01_v3:g.192111T>C', 'annotation': [], 'gene': 'UBP1'}], 'gene': 'UBP1'}, {'chrom': 'Pf3D7_01_v3', 'pos': 193667, 'ref': 'G', 'alt': 'C', 'depth': 42, 'freq': 0.95, 'sv': False, 'filter': 'pass', 'forward_reads': 20, 'reverse_reads': 20, 'sv_len': None, 'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'change': 'p.Arg1133Ser', 'nucleotide_change': 'c.3399G>C', 'protein_change': 'p.Arg1133Ser', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'nucleotide_change': 'c.3399G>C', 'protein_change': 'p.Arg1133Ser', 'sequence_hgvs': 'Pf3D7_01_v3:g.193667G>C', 'annotation': [], 'gene': 'UBP1'}], 'gene': 'UBP1'}, {'chrom': 'Pf3D7_01_v3', 'pos': 194117, 'ref': 'T', 'alt': 'C', 'depth': 24, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 17, 'reverse_reads': 7, 'sv_len': None, 'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'synonymous_variant', 'change': 'c.3849T>C', 'nucleotide_change': 'c.3849T>C', 'protein_change': 'p.Phe1283Phe', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'synonymous_variant', 'nucleotide_change': 'c.3849T>C', 'protein_change': 'p.Phe1283Phe', 'sequence_hgvs': 'Pf3D7_01_v3:g.194117T>C', 'annotation': [], 'gene': 'UBP1'}], 'gene': 'UBP1'}, {'chrom': 'Pf3D7_01_v3', 'pos': 196010, 'ref': 'A', 'alt': 'C', 'depth': 35, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 22, 'reverse_reads': 13, 'sv_len': None, 'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'change': 'p.Lys1914Asn', 'nucleotide_change': 'c.5742A>C', 'protein_change': 'p.Lys1914Asn', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'nucleotide_change': 'c.5742A>C', 'protein_change': 'p.Lys1914Asn', 'sequence_hgvs': 'Pf3D7_01_v3:g.196010A>C', 'annotation': [], 'gene': 'UBP1'}], 'gene': 'UBP1'}, {'chrom': 'Pf3D7_01_v3', 'pos': 196011, 'ref': 'G', 'alt': 'A', 'depth': 35, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 22, 'reverse_reads': 13, 'sv_len': None, 'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'change': 'p.Glu1915Lys', 'nucleotide_change': 'c.5743G>A', 'protein_change': 'p.Glu1915Lys', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'nucleotide_change': 'c.5743G>A', 'protein_change': 'p.Glu1915Lys', 'sequence_hgvs': 'Pf3D7_01_v3:g.196011G>A', 'annotation': [], 'gene': 'UBP1'}], 'gene': 'UBP1'}, {'chrom': 'Pf3D7_01_v3', 'pos': 196981, 'ref': 'G', 'alt': 'A', 'depth': 49, 'freq': 0.98, 'sv': False, 'filter': 'pass', 'forward_reads': 25, 'reverse_reads': 23, 'sv_len': None, 'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'change': 'p.Arg2238Lys', 'nucleotide_change': 'c.6713G>A', 'protein_change': 'p.Arg2238Lys', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'missense_variant', 'nucleotide_change': 'c.6713G>A', 'protein_change': 'p.Arg2238Lys', 'sequence_hgvs': 'Pf3D7_01_v3:g.196981G>A', 'annotation': [], 'gene': 'UBP1'}], 'gene': 'UBP1'}, {'chrom': 'Pf3D7_01_v3', 'pos': 199865, 'ref': 'CGTATGAATCATGCAAACCGTGTGAGTC', 'alt': 'C', 'depth': 30, 'freq': 0.53, 'sv': False, 'filter': 'pass', 'forward_reads': 4, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'disruptive_inframe_deletion', 'change': 'c.9365_9391delGTATGAATCATGCAAACCGTGTGAGTC', 'nucleotide_change': 'c.9365_9391delGTATGAATCATGCAAACCGTGTGAGTC', 'protein_change': 'p.Arg3122_Ser3130del', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0104300', 'feature_id': 'transcript:PF3D7_0104300', 'type': 'disruptive_inframe_deletion', 'nucleotide_change': 'c.9365_9391delGTATGAATCATGCAAACCGTGTGAGTC', 'protein_change': 'p.Arg3122_Ser3130del', 'sequence_hgvs': 'Pf3D7_01_v3:g.199865CGTATGAATCATGCAAACCGTGTGAGTC>C', 'annotation': [], 'gene': 'UBP1'}], 'gene': 'UBP1'}, {'chrom': 'Pf3D7_01_v3', 'pos': 380532, 'ref': 'A', 'alt': 'G', 'depth': 32, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 19, 'reverse_reads': 13, 'sv_len': None, 'gene_id': 'PF3D7_0109800', 'feature_id': 'transcript:PF3D7_0109800', 'type': 'upstream_gene_variant', 'change': 'c.-165A>G', 'nucleotide_change': 'c.-165A>G', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0109800', 'feature_id': 'transcript:PF3D7_0109800', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-165A>G', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_01_v3:g.380532A>G', 'annotation': [], 'gene': 'PF3D7_0109800'}], 'gene': 'PF3D7_0109800'}, {'chrom': 'Pf3D7_01_v3', 'pos': 381402, 'ref': 'A', 'alt': 'AATA', 'depth': 34, 'freq': 0.94, 'sv': False, 'filter': 'pass', 'forward_reads': 16, 'reverse_reads': 16, 'sv_len': None, 'gene_id': 'PF3D7_0109800', 'feature_id': 'transcript:PF3D7_0109800', 'type': 'disruptive_inframe_insertion', 'change': 'c.704_706dupATA', 'nucleotide_change': 'c.704_706dupATA', 'protein_change': 'p.Asn235dup', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0109800', 'feature_id': 'transcript:PF3D7_0109800', 'type': 'disruptive_inframe_insertion', 'nucleotide_change': 'c.704_706dupATA', 'protein_change': 'p.Asn235dup', 'sequence_hgvs': 'Pf3D7_01_v3:g.381402A>AATA', 'annotation': [], 'gene': 'PF3D7_0109800'}], 'gene': 'PF3D7_0109800'}, {'chrom': 'Pf3D7_03_v3', 'pos': 922867, 'ref': 'CAT', 'alt': 'C', 'depth': 21, 'freq': 0.95, 'sv': False, 'filter': 'pass', 'forward_reads': 14, 'reverse_reads': 6, 'sv_len': None, 'gene_id': 'PF3D7_0321900', 'feature_id': 'transcript:PF3D7_0321900', 'type': 'upstream_gene_variant', 'change': 'c.-106_-105delAT', 'nucleotide_change': 'c.-106_-105delAT', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0321900', 'feature_id': 'transcript:PF3D7_0321900', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-106_-105delAT', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_03_v3:g.922867CAT>C', 'annotation': [], 'gene': 'CARL'}], 'gene': 'CARL'}, {'chrom': 'Pf3D7_03_v3', 'pos': 925808, 'ref': 'A', 'alt': 'G', 'depth': 35, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 16, 'reverse_reads': 19, 'sv_len': None, 'gene_id': 'PF3D7_0321900', 'feature_id': 'transcript:PF3D7_0321900', 'type': 'missense_variant', 'change': 'p.Lys903Glu', 'nucleotide_change': 'c.2707A>G', 'protein_change': 'p.Lys903Glu', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0321900', 'feature_id': 'transcript:PF3D7_0321900', 'type': 'missense_variant', 'nucleotide_change': 'c.2707A>G', 'protein_change': 'p.Lys903Glu', 'sequence_hgvs': 'Pf3D7_03_v3:g.925808A>G', 'annotation': [], 'gene': 'CARL'}], 'gene': 'CARL'}, {'chrom': 'Pf3D7_04_v3', 'pos': 748516, 'ref': 'T', 'alt': 'C', 'depth': 42, 'freq': 0.98, 'sv': False, 'filter': 'pass', 'forward_reads': 25, 'reverse_reads': 16, 'sv_len': None, 'gene_id': 'PF3D7_0417200', 'feature_id': 'transcript:PF3D7_0417200', 'type': 'synonymous_variant', 'change': 'c.429T>C', 'nucleotide_change': 'c.429T>C', 'protein_change': 'p.Ile143Ile', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0417200', 'feature_id': 'transcript:PF3D7_0417200', 'type': 'synonymous_variant', 'nucleotide_change': 'c.429T>C', 'protein_change': 'p.Ile143Ile', 'sequence_hgvs': 'Pf3D7_04_v3:g.748516T>C', 'annotation': [], 'gene': 'DHFR-TS'}], 'gene': 'DHFR-TS'}, {'chrom': 'Pf3D7_05_v3', 'pos': 410338, 'ref': 'A', 'alt': 'T', 'depth': 12, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 6, 'reverse_reads': 6, 'sv_len': None, 'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'missense_variant', 'change': 'p.His24Leu', 'nucleotide_change': 'c.71A>T', 'protein_change': 'p.His24Leu', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'missense_variant', 'nucleotide_change': 'c.71A>T', 'protein_change': 'p.His24Leu', 'sequence_hgvs': 'Pf3D7_05_v3:g.410338A>T', 'annotation': [], 'gene': 'PI4K'}], 'gene': 'PI4K'}, {'chrom': 'Pf3D7_05_v3', 'pos': 412895, 'ref': 'C', 'alt': 'T', 'depth': 17, 'freq': 0.76, 'sv': False, 'filter': 'pass', 'forward_reads': 6, 'reverse_reads': 7, 'sv_len': None, 'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'synonymous_variant', 'change': 'c.2628C>T', 'nucleotide_change': 'c.2628C>T', 'protein_change': 'p.Asn876Asn', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'synonymous_variant', 'nucleotide_change': 'c.2628C>T', 'protein_change': 'p.Asn876Asn', 'sequence_hgvs': 'Pf3D7_05_v3:g.412895C>T', 'annotation': [], 'gene': 'PI4K'}], 'gene': 'PI4K'}, {'chrom': 'Pf3D7_05_v3', 'pos': 412896, 'ref': 'A', 'alt': 'G', 'depth': 17, 'freq': 0.76, 'sv': False, 'filter': 'pass', 'forward_reads': 6, 'reverse_reads': 7, 'sv_len': None, 'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'missense_variant', 'change': 'p.Asn877Asp', 'nucleotide_change': 'c.2629A>G', 'protein_change': 'p.Asn877Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'missense_variant', 'nucleotide_change': 'c.2629A>G', 'protein_change': 'p.Asn877Asp', 'sequence_hgvs': 'Pf3D7_05_v3:g.412896A>G', 'annotation': [], 'gene': 'PI4K'}], 'gene': 'PI4K'}, {'chrom': 'Pf3D7_05_v3', 'pos': 413426, 'ref': 'C', 'alt': 'T', 'depth': 31, 'freq': 0.97, 'sv': False, 'filter': 'pass', 'forward_reads': 19, 'reverse_reads': 11, 'sv_len': None, 'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'synonymous_variant', 'change': 'c.3159C>T', 'nucleotide_change': 'c.3159C>T', 'protein_change': 'p.Asp1053Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'synonymous_variant', 'nucleotide_change': 'c.3159C>T', 'protein_change': 'p.Asp1053Asp', 'sequence_hgvs': 'Pf3D7_05_v3:g.413426C>T', 'annotation': [], 'gene': 'PI4K'}], 'gene': 'PI4K'}, {'chrom': 'Pf3D7_05_v3', 'pos': 413958, 'ref': 'A', 'alt': 'AATA', 'depth': 13, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 3, 'sv_len': None, 'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'disruptive_inframe_insertion', 'change': 'c.3689_3691dupATA', 'nucleotide_change': 'c.3689_3691dupATA', 'protein_change': 'p.Asn1230dup', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'disruptive_inframe_insertion', 'nucleotide_change': 'c.3689_3691dupATA', 'protein_change': 'p.Asn1230dup', 'sequence_hgvs': 'Pf3D7_05_v3:g.413958A>AATA', 'annotation': [], 'gene': 'PI4K'}], 'gene': 'PI4K'}, {'chrom': 'Pf3D7_05_v3', 'pos': 415296, 'ref': 'T', 'alt': 'C', 'depth': 20, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 8, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'synonymous_variant', 'change': 'c.4668T>C', 'nucleotide_change': 'c.4668T>C', 'protein_change': 'p.Asn1556Asn', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0509800', 'feature_id': 'transcript:PF3D7_0509800', 'type': 'synonymous_variant', 'nucleotide_change': 'c.4668T>C', 'protein_change': 'p.Asn1556Asn', 'sequence_hgvs': 'Pf3D7_05_v3:g.415296T>C', 'annotation': [], 'gene': 'PI4K'}], 'gene': 'PI4K'}, {'chrom': 'Pf3D7_05_v3', 'pos': 959837, 'ref': 'G', 'alt': 'A', 'depth': 53, 'freq': 0.94, 'sv': False, 'filter': 'pass', 'forward_reads': 21, 'reverse_reads': 29, 'sv_len': None, 'gene_id': 'PF3D7_0523000', 'feature_id': 'transcript:PF3D7_0523000', 'type': 'missense_variant', 'change': 'p.Asp650Asn', 'nucleotide_change': 'c.1948G>A', 'protein_change': 'p.Asp650Asn', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0523000', 'feature_id': 'transcript:PF3D7_0523000', 'type': 'missense_variant', 'nucleotide_change': 'c.1948G>A', 'protein_change': 'p.Asp650Asn', 'sequence_hgvs': 'Pf3D7_05_v3:g.959837G>A', 'annotation': [], 'gene': 'MDR1'}], 'gene': 'MDR1'}, {'chrom': 'Pf3D7_05_v3', 'pos': 959843, 'ref': 'A', 'alt': 'G', 'depth': 53, 'freq': 0.94, 'sv': False, 'filter': 'pass', 'forward_reads': 21, 'reverse_reads': 29, 'sv_len': None, 'gene_id': 'PF3D7_0523000', 'feature_id': 'transcript:PF3D7_0523000', 'type': 'missense_variant', 'change': 'p.Asn652Asp', 'nucleotide_change': 'c.1954A>G', 'protein_change': 'p.Asn652Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0523000', 'feature_id': 'transcript:PF3D7_0523000', 'type': 'missense_variant', 'nucleotide_change': 'c.1954A>G', 'protein_change': 'p.Asn652Asp', 'sequence_hgvs': 'Pf3D7_05_v3:g.959843A>G', 'annotation': [], 'gene': 'MDR1'}], 'gene': 'MDR1'}, {'chrom': 'Pf3D7_05_v3', 'pos': 960046, 'ref': 'C', 'alt': 'T', 'depth': 26, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 13, 'reverse_reads': 13, 'sv_len': None, 'gene_id': 'PF3D7_0523000', 'feature_id': 'transcript:PF3D7_0523000', 'type': 'synonymous_variant', 'change': 'c.2157C>T', 'nucleotide_change': 'c.2157C>T', 'protein_change': 'p.Asp719Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0523000', 'feature_id': 'transcript:PF3D7_0523000', 'type': 'synonymous_variant', 'nucleotide_change': 'c.2157C>T', 'protein_change': 'p.Asp719Asp', 'sequence_hgvs': 'Pf3D7_05_v3:g.960046C>T', 'annotation': [], 'gene': 'MDR1'}], 'gene': 'MDR1'}, {'chrom': 'Pf3D7_07_v3', 'pos': 894384, 'ref': 'C', 'alt': 'G', 'depth': 28, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 14, 'reverse_reads': 14, 'sv_len': None, 'gene_id': 'PF3D7_0720700', 'feature_id': 'transcript:PF3D7_0720700', 'type': 'synonymous_variant', 'change': 'c.2175C>G', 'nucleotide_change': 'c.2175C>G', 'protein_change': 'p.Leu725Leu', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0720700', 'feature_id': 'transcript:PF3D7_0720700', 'type': 'synonymous_variant', 'nucleotide_change': 'c.2175C>G', 'protein_change': 'p.Leu725Leu', 'sequence_hgvs': 'Pf3D7_07_v3:g.894384C>G', 'annotation': [], 'gene': 'PF3D7_0720700'}], 'gene': 'PF3D7_0720700'}, {'chrom': 'Pf3D7_07_v3', 'pos': 895180, 'ref': 'A', 'alt': 'G', 'depth': 16, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 11, 'reverse_reads': 5, 'sv_len': None, 'gene_id': 'PF3D7_0720700', 'feature_id': 'transcript:PF3D7_0720700', 'type': 'missense_variant', 'change': 'p.Asn991Asp', 'nucleotide_change': 'c.2971A>G', 'protein_change': 'p.Asn991Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0720700', 'feature_id': 'transcript:PF3D7_0720700', 'type': 'missense_variant', 'nucleotide_change': 'c.2971A>G', 'protein_change': 'p.Asn991Asp', 'sequence_hgvs': 'Pf3D7_07_v3:g.895180A>G', 'annotation': [], 'gene': 'PF3D7_0720700'}], 'gene': 'PF3D7_0720700'}, {'chrom': 'Pf3D7_07_v3', 'pos': 896099, 'ref': 'T', 'alt': 'TAAACAATGT', 'depth': 45, 'freq': 0.78, 'sv': False, 'filter': 'pass', 'forward_reads': 17, 'reverse_reads': 18, 'sv_len': None, 'gene_id': 'PF3D7_0720700', 'feature_id': 'transcript:PF3D7_0720700', 'type': 'disruptive_inframe_insertion', 'change': 'c.3890_3891insAAACAATGT', 'nucleotide_change': 'c.3890_3891insAAACAATGT', 'protein_change': 'p.Val1297_Asn1298insAsnAsnVal', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0720700', 'feature_id': 'transcript:PF3D7_0720700', 'type': 'disruptive_inframe_insertion', 'nucleotide_change': 'c.3890_3891insAAACAATGT', 'protein_change': 'p.Val1297_Asn1298insAsnAsnVal', 'sequence_hgvs': 'Pf3D7_07_v3:g.896099T>TAAACAATGT', 'annotation': [], 'gene': 'PF3D7_0720700'}], 'gene': 'PF3D7_0720700'}, {'chrom': 'Pf3D7_07_v3', 'pos': 897236, 'ref': 'GTGTAAAAAG', 'alt': 'G', 'depth': 35, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 11, 'reverse_reads': 24, 'sv_len': None, 'gene_id': 'PF3D7_0720700', 'feature_id': 'transcript:PF3D7_0720700', 'type': 'disruptive_inframe_deletion', 'change': 'c.5028_5036delTGTAAAAAG', 'nucleotide_change': 'c.5028_5036delTGTAAAAAG', 'protein_change': 'p.Val1677_Ser1679del', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0720700', 'feature_id': 'transcript:PF3D7_0720700', 'type': 'disruptive_inframe_deletion', 'nucleotide_change': 'c.5028_5036delTGTAAAAAG', 'protein_change': 'p.Val1677_Ser1679del', 'sequence_hgvs': 'Pf3D7_07_v3:g.897236GTGTAAAAAG>G', 'annotation': [], 'gene': 'PF3D7_0720700'}], 'gene': 'PF3D7_0720700'}, {'chrom': 'Pf3D7_07_v3', 'pos': 898242, 'ref': 'C', 'alt': 'A', 'depth': 11, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 5, 'reverse_reads': 6, 'sv_len': None, 'gene_id': 'PF3D7_0720700', 'feature_id': 'transcript:PF3D7_0720700', 'type': 'synonymous_variant', 'change': 'c.6033C>A', 'nucleotide_change': 'c.6033C>A', 'protein_change': 'p.Ser2011Ser', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0720700', 'feature_id': 'transcript:PF3D7_0720700', 'type': 'synonymous_variant', 'nucleotide_change': 'c.6033C>A', 'protein_change': 'p.Ser2011Ser', 'sequence_hgvs': 'Pf3D7_07_v3:g.898242C>A', 'annotation': [], 'gene': 'PF3D7_0720700'}], 'gene': 'PF3D7_0720700'}, {'chrom': 'Pf3D7_08_v3', 'pos': 548068, 'ref': 'AAT', 'alt': 'A', 'depth': 30, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 15, 'reverse_reads': 15, 'sv_len': None, 'gene_id': 'PF3D7_0810800', 'feature_id': 'transcript:PF3D7_0810800', 'type': 'upstream_gene_variant', 'change': 'c.-131_-130delAT', 'nucleotide_change': 'c.-131_-130delAT', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0810800', 'feature_id': 'transcript:PF3D7_0810800', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-131_-130delAT', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_08_v3:g.548068AAT>A', 'annotation': [], 'gene': 'PPPK-DHPS'}], 'gene': 'PPPK-DHPS'}, {'chrom': 'Pf3D7_08_v3', 'pos': 548801, 'ref': 'G', 'alt': 'A', 'depth': 27, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 17, 'reverse_reads': 10, 'sv_len': None, 'gene_id': 'PF3D7_0810800', 'feature_id': 'transcript:PF3D7_0810800', 'type': 'synonymous_variant', 'change': 'c.426G>A', 'nucleotide_change': 'c.426G>A', 'protein_change': 'p.Lys142Lys', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0810800', 'feature_id': 'transcript:PF3D7_0810800', 'type': 'synonymous_variant', 'nucleotide_change': 'c.426G>A', 'protein_change': 'p.Lys142Lys', 'sequence_hgvs': 'Pf3D7_08_v3:g.548801G>A', 'annotation': [], 'gene': 'PPPK-DHPS'}], 'gene': 'PPPK-DHPS'}, {'chrom': 'Pf3D7_08_v3', 'pos': 643648, 'ref': 'C', 'alt': 'CTCATATTAT', 'depth': 38, 'freq': 0.74, 'sv': False, 'filter': 'pass', 'forward_reads': 17, 'reverse_reads': 11, 'sv_len': None, 'gene_id': 'PF3D7_0813000', 'feature_id': 'transcript:PF3D7_0813000', 'type': 'conservative_inframe_insertion', 'change': 'c.1229_1237dupATAATATGA', 'nucleotide_change': 'c.1229_1237dupATAATATGA', 'protein_change': 'p.Asn410_Met412dup', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0813000', 'feature_id': 'transcript:PF3D7_0813000', 'type': 'conservative_inframe_insertion', 'nucleotide_change': 'c.1229_1237dupATAATATGA', 'protein_change': 'p.Asn410_Met412dup', 'sequence_hgvs': 'Pf3D7_08_v3:g.643648C>CTCATATTAT', 'annotation': [], 'gene': 'PF3D7_0813000'}], 'gene': 'PF3D7_0813000'}, {'chrom': 'Pf3D7_08_v3', 'pos': 644383, 'ref': 'TTATCTTTATCTC', 'alt': 'T', 'depth': 9, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 5, 'reverse_reads': 4, 'sv_len': None, 'gene_id': 'PF3D7_0813000', 'feature_id': 'transcript:PF3D7_0813000', 'type': 'disruptive_inframe_deletion', 'change': 'c.491_502delGAGATAAAGATA', 'nucleotide_change': 'c.491_502delGAGATAAAGATA', 'protein_change': 'p.Arg164_Asp167del', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_0813000', 'feature_id': 'transcript:PF3D7_0813000', 'type': 'disruptive_inframe_deletion', 'nucleotide_change': 'c.491_502delGAGATAAAGATA', 'protein_change': 'p.Arg164_Asp167del', 'sequence_hgvs': 'Pf3D7_08_v3:g.644383TTATCTTTATCTC>T', 'annotation': [], 'gene': 'PF3D7_0813000'}], 'gene': 'PF3D7_0813000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1046204, 'ref': 'C', 'alt': 'T', 'depth': 49, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 22, 'reverse_reads': 27, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Arg859Lys', 'nucleotide_change': 'c.2576G>A', 'protein_change': 'p.Arg859Lys', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.2576G>A', 'protein_change': 'p.Arg859Lys', 'sequence_hgvs': 'Pf3D7_10_v3:g.1046204C>T', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1046830, 'ref': 'T', 'alt': 'A', 'depth': 43, 'freq': 0.95, 'sv': False, 'filter': 'pass', 'forward_reads': 20, 'reverse_reads': 21, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'synonymous_variant', 'change': 'c.1950A>T', 'nucleotide_change': 'c.1950A>T', 'protein_change': 'p.Ile650Ile', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'synonymous_variant', 'nucleotide_change': 'c.1950A>T', 'protein_change': 'p.Ile650Ile', 'sequence_hgvs': 'Pf3D7_10_v3:g.1046830T>A', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047084, 'ref': 'T', 'alt': 'C', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Asn566Asp', 'nucleotide_change': 'c.1696A>G', 'protein_change': 'p.Asn566Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1696A>G', 'protein_change': 'p.Asn566Asp', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047084T>C', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047087, 'ref': 'T', 'alt': 'C', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Asn565Asp', 'nucleotide_change': 'c.1693A>G', 'protein_change': 'p.Asn565Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1693A>G', 'protein_change': 'p.Asn565Asp', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047087T>C', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047093, 'ref': 'AT', 'alt': 'CA', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Tyr563Asp', 'nucleotide_change': 'c.1686_1687delATinsTG', 'protein_change': 'p.Tyr563Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1686_1687delATinsTG', 'protein_change': 'p.Tyr563Asp', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047093AT>CA', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047095, 'ref': 'GT', 'alt': 'TC', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Thr562Glu', 'nucleotide_change': 'c.1684_1685delACinsGA', 'protein_change': 'p.Thr562Glu', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1684_1685delACinsGA', 'protein_change': 'p.Thr562Glu', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047095GT>TC', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047108, 'ref': 'T', 'alt': 'C', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Asn558Asp', 'nucleotide_change': 'c.1672A>G', 'protein_change': 'p.Asn558Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1672A>G', 'protein_change': 'p.Asn558Asp', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047108T>C', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047111, 'ref': 'TA', 'alt': 'AT', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.AsnAsn556LysTyr', 'nucleotide_change': 'c.1668_1669delTAinsAT', 'protein_change': 'p.AsnAsn556LysTyr', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1668_1669delTAinsAT', 'protein_change': 'p.AsnAsn556LysTyr', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047111TA>AT', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047113, 'ref': 'T', 'alt': 'G', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Asn556Thr', 'nucleotide_change': 'c.1667A>C', 'protein_change': 'p.Asn556Thr', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1667A>C', 'protein_change': 'p.Asn556Thr', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047113T>G', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047117, 'ref': 'C', 'alt': 'T', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Asp555Asn', 'nucleotide_change': 'c.1663G>A', 'protein_change': 'p.Asp555Asn', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1663G>A', 'protein_change': 'p.Asp555Asn', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047117C>T', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047120, 'ref': 'AT', 'alt': 'TA', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Tyr554Asn', 'nucleotide_change': 'c.1659_1660delATinsTA', 'protein_change': 'p.Tyr554Asn', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1659_1660delATinsTA', 'protein_change': 'p.Tyr554Asn', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047120AT>TA', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047122, 'ref': 'G', 'alt': 'T', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Thr553Lys', 'nucleotide_change': 'c.1658C>A', 'protein_change': 'p.Thr553Lys', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1658C>A', 'protein_change': 'p.Thr553Lys', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047122G>T', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047135, 'ref': 'T', 'alt': 'C', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Asn549Asp', 'nucleotide_change': 'c.1645A>G', 'protein_change': 'p.Asn549Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1645A>G', 'protein_change': 'p.Asn549Asp', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047135T>C', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047138, 'ref': 'TA', 'alt': 'AT', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.AsnAsn547LysTyr', 'nucleotide_change': 'c.1641_1642delTAinsAT', 'protein_change': 'p.AsnAsn547LysTyr', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1641_1642delTAinsAT', 'protein_change': 'p.AsnAsn547LysTyr', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047138TA>AT', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047140, 'ref': 'T', 'alt': 'G', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Asn547Thr', 'nucleotide_change': 'c.1640A>C', 'protein_change': 'p.Asn547Thr', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1640A>C', 'protein_change': 'p.Asn547Thr', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047140T>G', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047143, 'ref': 'TCATATG', 'alt': 'T', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 10, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'disruptive_inframe_deletion', 'change': 'c.1631_1636delCATATG', 'nucleotide_change': 'c.1631_1636delCATATG', 'protein_change': 'p.Thr544_Asp546delinsAsn', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'disruptive_inframe_deletion', 'nucleotide_change': 'c.1631_1636delCATATG', 'protein_change': 'p.Thr544_Asp546delinsAsn', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047143TCATATG>T', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047323, 'ref': 'A', 'alt': 'G', 'depth': 48, 'freq': 0.98, 'sv': False, 'filter': 'pass', 'forward_reads': 20, 'reverse_reads': 27, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Phe486Ser', 'nucleotide_change': 'c.1457T>C', 'protein_change': 'p.Phe486Ser', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1457T>C', 'protein_change': 'p.Phe486Ser', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047323A>G', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1047779, 'ref': 'C', 'alt': 'T', 'depth': 33, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 19, 'reverse_reads': 14, 'sv_len': None, 'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'change': 'p.Gly334Glu', 'nucleotide_change': 'c.1001G>A', 'protein_change': 'p.Gly334Glu', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1025000', 'feature_id': 'transcript:PF3D7_1025000', 'type': 'missense_variant', 'nucleotide_change': 'c.1001G>A', 'protein_change': 'p.Gly334Glu', 'sequence_hgvs': 'Pf3D7_10_v3:g.1047779C>T', 'annotation': [], 'gene': 'PF3D7_1025000'}], 'gene': 'PF3D7_1025000'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1449646, 'ref': 'G', 'alt': 'A', 'depth': 39, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 18, 'reverse_reads': 21, 'sv_len': None, 'gene_id': 'PF3D7_1036800', 'feature_id': 'transcript:PF3D7_1036800', 'type': 'missense_variant', 'change': 'p.Thr459Ile', 'nucleotide_change': 'c.1376C>T', 'protein_change': 'p.Thr459Ile', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1036800', 'feature_id': 'transcript:PF3D7_1036800', 'type': 'missense_variant', 'nucleotide_change': 'c.1376C>T', 'protein_change': 'p.Thr459Ile', 'sequence_hgvs': 'Pf3D7_10_v3:g.1449646G>A', 'annotation': [], 'gene': 'PF3D7_1036800'}], 'gene': 'PF3D7_1036800'}, {'chrom': 'Pf3D7_10_v3', 'pos': 1451029, 'ref': 'C', 'alt': 'T', 'depth': 21, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 14, 'reverse_reads': 7, 'sv_len': None, 'gene_id': 'PF3D7_1036800', 'feature_id': 'transcript:PF3D7_1036800', 'type': 'missense_variant', 'change': 'p.Arg104Lys', 'nucleotide_change': 'c.311G>A', 'protein_change': 'p.Arg104Lys', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1036800', 'feature_id': 'transcript:PF3D7_1036800', 'type': 'missense_variant', 'nucleotide_change': 'c.311G>A', 'protein_change': 'p.Arg104Lys', 'sequence_hgvs': 'Pf3D7_10_v3:g.1451029C>T', 'annotation': [], 'gene': 'PF3D7_1036800'}], 'gene': 'PF3D7_1036800'}, {'chrom': 'Pf3D7_11_v3', 'pos': 1526106, 'ref': 'A', 'alt': 'C', 'depth': 35, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 18, 'reverse_reads': 17, 'sv_len': None, 'gene_id': 'PF3D7_1138700', 'feature_id': 'transcript:PF3D7_1138700', 'type': 'missense_variant', 'change': 'p.Ser1721Ala', 'nucleotide_change': 'c.5161T>G', 'protein_change': 'p.Ser1721Ala', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1138700', 'feature_id': 'transcript:PF3D7_1138700', 'type': 'missense_variant', 'nucleotide_change': 'c.5161T>G', 'protein_change': 'p.Ser1721Ala', 'sequence_hgvs': 'Pf3D7_11_v3:g.1526106A>C', 'annotation': [], 'gene': 'PF3D7_1138700'}], 'gene': 'PF3D7_1138700'}, {'chrom': 'Pf3D7_11_v3', 'pos': 1528120, 'ref': 'T', 'alt': 'A', 'depth': 27, 'freq': 0.96, 'sv': False, 'filter': 'pass', 'forward_reads': 11, 'reverse_reads': 15, 'sv_len': None, 'gene_id': 'PF3D7_1138700', 'feature_id': 'transcript:PF3D7_1138700', 'type': 'missense_variant', 'change': 'p.Glu1049Asp', 'nucleotide_change': 'c.3147A>T', 'protein_change': 'p.Glu1049Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1138700', 'feature_id': 'transcript:PF3D7_1138700', 'type': 'missense_variant', 'nucleotide_change': 'c.3147A>T', 'protein_change': 'p.Glu1049Asp', 'sequence_hgvs': 'Pf3D7_11_v3:g.1528120T>A', 'annotation': [], 'gene': 'PF3D7_1138700'}], 'gene': 'PF3D7_1138700'}, {'chrom': 'Pf3D7_11_v3', 'pos': 1529369, 'ref': 'C', 'alt': 'T', 'depth': 21, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 13, 'reverse_reads': 8, 'sv_len': None, 'gene_id': 'PF3D7_1138700', 'feature_id': 'transcript:PF3D7_1138700', 'type': 'missense_variant', 'change': 'p.Ser633Asn', 'nucleotide_change': 'c.1898G>A', 'protein_change': 'p.Ser633Asn', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1138700', 'feature_id': 'transcript:PF3D7_1138700', 'type': 'missense_variant', 'nucleotide_change': 'c.1898G>A', 'protein_change': 'p.Ser633Asn', 'sequence_hgvs': 'Pf3D7_11_v3:g.1529369C>T', 'annotation': [], 'gene': 'PF3D7_1138700'}], 'gene': 'PF3D7_1138700'}, {'chrom': 'Pf3D7_11_v3', 'pos': 1529778, 'ref': 'C', 'alt': 'G', 'depth': 41, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 21, 'reverse_reads': 20, 'sv_len': None, 'gene_id': 'PF3D7_1138700', 'feature_id': 'transcript:PF3D7_1138700', 'type': 'missense_variant', 'change': 'p.Glu497Gln', 'nucleotide_change': 'c.1489G>C', 'protein_change': 'p.Glu497Gln', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1138700', 'feature_id': 'transcript:PF3D7_1138700', 'type': 'missense_variant', 'nucleotide_change': 'c.1489G>C', 'protein_change': 'p.Glu497Gln', 'sequence_hgvs': 'Pf3D7_11_v3:g.1529778C>G', 'annotation': [], 'gene': 'PF3D7_1138700'}], 'gene': 'PF3D7_1138700'}, {'chrom': 'Pf3D7_11_v3', 'pos': 1529908, 'ref': 'A', 'alt': 'G', 'depth': 31, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 14, 'reverse_reads': 17, 'sv_len': None, 'gene_id': 'PF3D7_1138700', 'feature_id': 'transcript:PF3D7_1138700', 'type': 'synonymous_variant', 'change': 'c.1359T>C', 'nucleotide_change': 'c.1359T>C', 'protein_change': 'p.Asn453Asn', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1138700', 'feature_id': 'transcript:PF3D7_1138700', 'type': 'synonymous_variant', 'nucleotide_change': 'c.1359T>C', 'protein_change': 'p.Asn453Asn', 'sequence_hgvs': 'Pf3D7_11_v3:g.1529908A>G', 'annotation': [], 'gene': 'PF3D7_1138700'}], 'gene': 'PF3D7_1138700'}, {'chrom': 'Pf3D7_12_v3', 'pos': 529418, 'ref': 'C', 'alt': 'T', 'depth': 51, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 26, 'reverse_reads': 25, 'sv_len': None, 'gene_id': 'PF3D7_1211900', 'feature_id': 'transcript:PF3D7_1211900', 'type': 'missense_variant', 'change': 'p.Gly1128Arg', 'nucleotide_change': 'c.3382G>A', 'protein_change': 'p.Gly1128Arg', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1211900', 'feature_id': 'transcript:PF3D7_1211900', 'type': 'missense_variant', 'nucleotide_change': 'c.3382G>A', 'protein_change': 'p.Gly1128Arg', 'sequence_hgvs': 'Pf3D7_12_v3:g.529418C>T', 'annotation': [], 'gene': 'ATP4'}], 'gene': 'ATP4'}, {'chrom': 'Pf3D7_12_v3', 'pos': 529559, 'ref': 'G', 'alt': 'T', 'depth': 38, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 14, 'reverse_reads': 24, 'sv_len': None, 'gene_id': 'PF3D7_1211900', 'feature_id': 'transcript:PF3D7_1211900', 'type': 'missense_variant', 'change': 'p.Gln1081Lys', 'nucleotide_change': 'c.3241C>A', 'protein_change': 'p.Gln1081Lys', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1211900', 'feature_id': 'transcript:PF3D7_1211900', 'type': 'missense_variant', 'nucleotide_change': 'c.3241C>A', 'protein_change': 'p.Gln1081Lys', 'sequence_hgvs': 'Pf3D7_12_v3:g.529559G>T', 'annotation': [], 'gene': 'ATP4'}], 'gene': 'ATP4'}, {'chrom': 'Pf3D7_12_v3', 'pos': 532887, 'ref': 'T', 'alt': 'G', 'depth': 43, 'freq': 0.98, 'sv': False, 'filter': 'pass', 'forward_reads': 26, 'reverse_reads': 16, 'sv_len': None, 'gene_id': 'PF3D7_1211900', 'feature_id': 'transcript:PF3D7_1211900', 'type': 'upstream_gene_variant', 'change': 'c.-88A>C', 'nucleotide_change': 'c.-88A>C', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1211900', 'feature_id': 'transcript:PF3D7_1211900', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-88A>C', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_12_v3:g.532887T>G', 'annotation': [], 'gene': 'ATP4'}], 'gene': 'ATP4'}, {'chrom': 'Pf3D7_12_v3', 'pos': 532889, 'ref': 'G', 'alt': 'T', 'depth': 43, 'freq': 0.98, 'sv': False, 'filter': 'pass', 'forward_reads': 26, 'reverse_reads': 16, 'sv_len': None, 'gene_id': 'PF3D7_1211900', 'feature_id': 'transcript:PF3D7_1211900', 'type': 'upstream_gene_variant', 'change': 'c.-90C>A', 'nucleotide_change': 'c.-90C>A', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1211900', 'feature_id': 'transcript:PF3D7_1211900', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-90C>A', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_12_v3:g.532889G>T', 'annotation': [], 'gene': 'ATP4'}], 'gene': 'ATP4'}, {'chrom': 'Pf3D7_12_v3', 'pos': 592234, 'ref': 'C', 'alt': 'T', 'depth': 44, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 20, 'reverse_reads': 24, 'sv_len': None, 'gene_id': 'PF3D7_1213800', 'feature_id': 'transcript:PF3D7_1213800', 'type': 'synonymous_variant', 'change': 'c.201G>A', 'nucleotide_change': 'c.201G>A', 'protein_change': 'p.Lys67Lys', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1213800', 'feature_id': 'transcript:PF3D7_1213800', 'type': 'synonymous_variant', 'nucleotide_change': 'c.201G>A', 'protein_change': 'p.Lys67Lys', 'sequence_hgvs': 'Pf3D7_12_v3:g.592234C>T', 'annotation': [], 'gene': 'PRS'}], 'gene': 'PRS'}, {'chrom': 'Pf3D7_12_v3', 'pos': 592496, 'ref': 'C', 'alt': 'T', 'depth': 24, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 11, 'reverse_reads': 13, 'sv_len': None, 'gene_id': 'PF3D7_1213800', 'feature_id': 'transcript:PF3D7_1213800', 'type': 'upstream_gene_variant', 'change': 'c.-62G>A', 'nucleotide_change': 'c.-62G>A', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1213800', 'feature_id': 'transcript:PF3D7_1213800', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-62G>A', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_12_v3:g.592496C>T', 'annotation': [], 'gene': 'PRS'}], 'gene': 'PRS'}, {'chrom': 'Pf3D7_12_v3', 'pos': 592610, 'ref': 'ATATATATATATATATATATT', 'alt': 'A', 'depth': 20, 'freq': 0.95, 'sv': False, 'filter': 'pass', 'forward_reads': 8, 'reverse_reads': 11, 'sv_len': None, 'gene_id': 'PF3D7_1213800', 'feature_id': 'transcript:PF3D7_1213800', 'type': 'upstream_gene_variant', 'change': 'c.-196_-177delAATATATATATATATATATA', 'nucleotide_change': 'c.-196_-177delAATATATATATATATATATA', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1213800', 'feature_id': 'transcript:PF3D7_1213800', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-196_-177delAATATATATATATATATATA', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_12_v3:g.592610ATATATATATATATATATATT>A', 'annotation': [], 'gene': 'PRS'}], 'gene': 'PRS'}, {'chrom': 'Pf3D7_12_v3', 'pos': 1927229, 'ref': 'T', 'alt': 'C', 'depth': 30, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 20, 'reverse_reads': 10, 'sv_len': None, 'gene_id': 'PF3D7_1246300', 'feature_id': 'transcript:PF3D7_1246300', 'type': 'synonymous_variant', 'change': 'c.1041T>C', 'nucleotide_change': 'c.1041T>C', 'protein_change': 'p.Phe347Phe', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1246300', 'feature_id': 'transcript:PF3D7_1246300', 'type': 'synonymous_variant', 'nucleotide_change': 'c.1041T>C', 'protein_change': 'p.Phe347Phe', 'sequence_hgvs': 'Pf3D7_12_v3:g.1927229T>C', 'annotation': [], 'gene': 'PF3D7_1246300'}], 'gene': 'PF3D7_1246300'}, {'chrom': 'Pf3D7_12_v3', 'pos': 2092045, 'ref': 'A', 'alt': 'AATATAT', 'depth': 10, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 4, 'reverse_reads': 6, 'sv_len': None, 'gene_id': 'PF3D7_1251200', 'feature_id': 'transcript:PF3D7_1251200', 'type': 'upstream_gene_variant', 'change': 'c.-42_-41insATATAT', 'nucleotide_change': 'c.-42_-41insATATAT', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1251200', 'feature_id': 'transcript:PF3D7_1251200', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-42_-41insATATAT', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_12_v3:g.2092045A>AATATAT', 'annotation': [], 'gene': 'PF3D7_1251200'}], 'gene': 'PF3D7_1251200'}, {'chrom': 'Pf3D7_12_v3', 'pos': 2092969, 'ref': 'A', 'alt': 'G', 'depth': 17, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 7, 'reverse_reads': 10, 'sv_len': None, 'gene_id': 'PF3D7_1251200', 'feature_id': 'transcript:PF3D7_1251200', 'type': 'missense_variant', 'change': 'p.Ser183Gly', 'nucleotide_change': 'c.547A>G', 'protein_change': 'p.Ser183Gly', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1251200', 'feature_id': 'transcript:PF3D7_1251200', 'type': 'missense_variant', 'nucleotide_change': 'c.547A>G', 'protein_change': 'p.Ser183Gly', 'sequence_hgvs': 'Pf3D7_12_v3:g.2092969A>G', 'annotation': [], 'gene': 'PF3D7_1251200'}], 'gene': 'PF3D7_1251200'}, {'chrom': 'Pf3D7_12_v3', 'pos': 2093058, 'ref': 'A', 'alt': 'G', 'depth': 17, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 7, 'reverse_reads': 10, 'sv_len': None, 'gene_id': 'PF3D7_1251200', 'feature_id': 'transcript:PF3D7_1251200', 'type': 'synonymous_variant', 'change': 'c.636A>G', 'nucleotide_change': 'c.636A>G', 'protein_change': 'p.Lys212Lys', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1251200', 'feature_id': 'transcript:PF3D7_1251200', 'type': 'synonymous_variant', 'nucleotide_change': 'c.636A>G', 'protein_change': 'p.Lys212Lys', 'sequence_hgvs': 'Pf3D7_12_v3:g.2093058A>G', 'annotation': [], 'gene': 'PF3D7_1251200'}], 'gene': 'PF3D7_1251200'}, {'chrom': 'Pf3D7_13_v3', 'pos': 1726432, 'ref': 'T', 'alt': 'G', 'depth': 49, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 21, 'reverse_reads': 28, 'sv_len': None, 'gene_id': 'PF3D7_1343700', 'feature_id': 'transcript:PF3D7_1343700', 'type': 'missense_variant', 'change': 'p.Lys189Thr', 'nucleotide_change': 'c.566A>C', 'protein_change': 'p.Lys189Thr', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1343700', 'feature_id': 'transcript:PF3D7_1343700', 'type': 'missense_variant', 'nucleotide_change': 'c.566A>C', 'protein_change': 'p.Lys189Thr', 'sequence_hgvs': 'Pf3D7_13_v3:g.1726432T>G', 'annotation': [], 'gene': 'K13'}], 'gene': 'K13'}, {'chrom': 'Pf3D7_13_v3', 'pos': 1727052, 'ref': 'T', 'alt': 'A', 'depth': 15, 'freq': 0.93, 'sv': False, 'filter': 'pass', 'forward_reads': 5, 'reverse_reads': 9, 'sv_len': None, 'gene_id': 'PF3D7_1343700', 'feature_id': 'transcript:PF3D7_1343700', 'type': 'upstream_gene_variant', 'change': 'c.-55A>T', 'nucleotide_change': 'c.-55A>T', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1343700', 'feature_id': 'transcript:PF3D7_1343700', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-55A>T', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_13_v3:g.1727052T>A', 'annotation': [], 'gene': 'K13'}], 'gene': 'K13'}, {'chrom': 'Pf3D7_13_v3', 'pos': 1727056, 'ref': 'T', 'alt': 'A', 'depth': 15, 'freq': 0.93, 'sv': False, 'filter': 'pass', 'forward_reads': 5, 'reverse_reads': 9, 'sv_len': None, 'gene_id': 'PF3D7_1343700', 'feature_id': 'transcript:PF3D7_1343700', 'type': 'upstream_gene_variant', 'change': 'c.-59A>T', 'nucleotide_change': 'c.-59A>T', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1343700', 'feature_id': 'transcript:PF3D7_1343700', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-59A>T', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_13_v3:g.1727056T>A', 'annotation': [], 'gene': 'K13'}], 'gene': 'K13'}, {'chrom': 'Pf3D7_13_v3', 'pos': 1727071, 'ref': 'ATATATATATATATATATATATATATATATT', 'alt': 'A', 'depth': 15, 'freq': 0.93, 'sv': False, 'filter': 'pass', 'forward_reads': 5, 'reverse_reads': 9, 'sv_len': None, 'gene_id': 'PF3D7_1343700', 'feature_id': 'transcript:PF3D7_1343700', 'type': 'upstream_gene_variant', 'change': 'c.-104_-75delAATATATATATATATATATATATATATATA', 'nucleotide_change': 'c.-104_-75delAATATATATATATATATATATATATATATA', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1343700', 'feature_id': 'transcript:PF3D7_1343700', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-104_-75delAATATATATATATATATATATATATATATA', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_13_v3:g.1727071ATATATATATATATATATATATATATATATT>A', 'annotation': [], 'gene': 'K13'}], 'gene': 'K13'}, {'chrom': 'Pf3D7_14_v3', 'pos': 1550691, 'ref': 'T', 'alt': 'A', 'depth': 22, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 12, 'reverse_reads': 10, 'sv_len': None, 'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'missense_variant', 'change': 'p.Asp226Glu', 'nucleotide_change': 'c.678T>A', 'protein_change': 'p.Asp226Glu', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'missense_variant', 'nucleotide_change': 'c.678T>A', 'protein_change': 'p.Asp226Glu', 'sequence_hgvs': 'Pf3D7_14_v3:g.1550691T>A', 'annotation': [], 'gene': 'MCA2'}], 'gene': 'MCA2'}, {'chrom': 'Pf3D7_14_v3', 'pos': 1550916, 'ref': 'TAAT', 'alt': 'T', 'depth': 43, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 22, 'reverse_reads': 21, 'sv_len': None, 'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'conservative_inframe_deletion', 'change': 'c.904_906delAAT', 'nucleotide_change': 'c.904_906delAAT', 'protein_change': 'p.Asn302del', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'conservative_inframe_deletion', 'nucleotide_change': 'c.904_906delAAT', 'protein_change': 'p.Asn302del', 'sequence_hgvs': 'Pf3D7_14_v3:g.1550916TAAT>T', 'annotation': [], 'gene': 'MCA2'}], 'gene': 'MCA2'}, {'chrom': 'Pf3D7_14_v3', 'pos': 1553197, 'ref': 'G', 'alt': 'C', 'depth': 20, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 8, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'missense_variant', 'change': 'p.Glu1062Gln', 'nucleotide_change': 'c.3184G>C', 'protein_change': 'p.Glu1062Gln', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'missense_variant', 'nucleotide_change': 'c.3184G>C', 'protein_change': 'p.Glu1062Gln', 'sequence_hgvs': 'Pf3D7_14_v3:g.1553197G>C', 'annotation': [], 'gene': 'MCA2'}], 'gene': 'MCA2'}, {'chrom': 'Pf3D7_14_v3', 'pos': 1553266, 'ref': 'A', 'alt': 'G', 'depth': 20, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 8, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'missense_variant', 'change': 'p.Asn1085Asp', 'nucleotide_change': 'c.3253A>G', 'protein_change': 'p.Asn1085Asp', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'missense_variant', 'nucleotide_change': 'c.3253A>G', 'protein_change': 'p.Asn1085Asp', 'sequence_hgvs': 'Pf3D7_14_v3:g.1553266A>G', 'annotation': [], 'gene': 'MCA2'}], 'gene': 'MCA2'}, {'chrom': 'Pf3D7_14_v3', 'pos': 1553649, 'ref': 'C', 'alt': 'T', 'depth': 41, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 20, 'reverse_reads': 21, 'sv_len': None, 'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'synonymous_variant', 'change': 'c.3636C>T', 'nucleotide_change': 'c.3636C>T', 'protein_change': 'p.His1212His', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'synonymous_variant', 'nucleotide_change': 'c.3636C>T', 'protein_change': 'p.His1212His', 'sequence_hgvs': 'Pf3D7_14_v3:g.1553649C>T', 'annotation': [], 'gene': 'MCA2'}], 'gene': 'MCA2'}, {'chrom': 'Pf3D7_14_v3', 'pos': 1553661, 'ref': 'T', 'alt': 'C', 'depth': 41, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 20, 'reverse_reads': 21, 'sv_len': None, 'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'synonymous_variant', 'change': 'c.3648T>C', 'nucleotide_change': 'c.3648T>C', 'protein_change': 'p.His1216His', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'synonymous_variant', 'nucleotide_change': 'c.3648T>C', 'protein_change': 'p.His1216His', 'sequence_hgvs': 'Pf3D7_14_v3:g.1553661T>C', 'annotation': [], 'gene': 'MCA2'}], 'gene': 'MCA2'}, {'chrom': 'Pf3D7_14_v3', 'pos': 1553697, 'ref': 'C', 'alt': 'T', 'depth': 41, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 20, 'reverse_reads': 21, 'sv_len': None, 'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'synonymous_variant', 'change': 'c.3684C>T', 'nucleotide_change': 'c.3684C>T', 'protein_change': 'p.His1228His', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'synonymous_variant', 'nucleotide_change': 'c.3684C>T', 'protein_change': 'p.His1228His', 'sequence_hgvs': 'Pf3D7_14_v3:g.1553697C>T', 'annotation': [], 'gene': 'MCA2'}], 'gene': 'MCA2'}, {'chrom': 'Pf3D7_14_v3', 'pos': 1554029, 'ref': 'A', 'alt': 'C', 'depth': 17, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 5, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'missense_variant', 'change': 'p.Glu1339Ala', 'nucleotide_change': 'c.4016A>C', 'protein_change': 'p.Glu1339Ala', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'missense_variant', 'nucleotide_change': 'c.4016A>C', 'protein_change': 'p.Glu1339Ala', 'sequence_hgvs': 'Pf3D7_14_v3:g.1554029A>C', 'annotation': [], 'gene': 'MCA2'}], 'gene': 'MCA2'}, {'chrom': 'Pf3D7_14_v3', 'pos': 1554098, 'ref': 'C', 'alt': 'T', 'depth': 17, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 5, 'reverse_reads': 12, 'sv_len': None, 'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'missense_variant', 'change': 'p.Thr1362Ile', 'nucleotide_change': 'c.4085C>T', 'protein_change': 'p.Thr1362Ile', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'missense_variant', 'nucleotide_change': 'c.4085C>T', 'protein_change': 'p.Thr1362Ile', 'sequence_hgvs': 'Pf3D7_14_v3:g.1554098C>T', 'annotation': [], 'gene': 'MCA2'}], 'gene': 'MCA2'}, {'chrom': 'Pf3D7_14_v3', 'pos': 1554318, 'ref': 'G', 'alt': 'A', 'depth': 33, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 17, 'reverse_reads': 16, 'sv_len': None, 'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'synonymous_variant', 'change': 'c.4305G>A', 'nucleotide_change': 'c.4305G>A', 'protein_change': 'p.Glu1435Glu', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1438400', 'feature_id': 'transcript:PF3D7_1438400', 'type': 'synonymous_variant', 'nucleotide_change': 'c.4305G>A', 'protein_change': 'p.Glu1435Glu', 'sequence_hgvs': 'Pf3D7_14_v3:g.1554318G>A', 'annotation': [], 'gene': 'MCA2'}], 'gene': 'MCA2'}, {'chrom': 'Pf3D7_14_v3', 'pos': 2090784, 'ref': 'A', 'alt': 'AAT', 'depth': 24, 'freq': 0.75, 'sv': False, 'filter': 'pass', 'forward_reads': 8, 'reverse_reads': 10, 'sv_len': None, 'gene_id': 'PF3D7_1451100', 'feature_id': 'transcript:PF3D7_1451100', 'type': 'upstream_gene_variant', 'change': 'c.-118_-117insAT', 'nucleotide_change': 'c.-118_-117insAT', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1451100', 'feature_id': 'transcript:PF3D7_1451100', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-118_-117insAT', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_14_v3:g.2090784A>AAT', 'annotation': [], 'gene': 'eEF2'}], 'gene': 'eEF2'}, {'chrom': 'Pf3D7_14_v3', 'pos': 2480289, 'ref': 'T', 'alt': 'A', 'depth': 26, 'freq': 1.0, 'sv': False, 'filter': 'pass', 'forward_reads': 12, 'reverse_reads': 14, 'sv_len': None, 'gene_id': 'PF3D7_1460900', 'feature_id': 'transcript:PF3D7_1460900', 'type': 'upstream_gene_variant', 'change': 'c.-151T>A', 'nucleotide_change': 'c.-151T>A', 'protein_change': '', 'annotation': [], 'consequences': [{'gene_id': 'PF3D7_1460900', 'feature_id': 'transcript:PF3D7_1460900', 'type': 'upstream_gene_variant', 'nucleotide_change': 'c.-151T>A', 'protein_change': '', 'sequence_hgvs': 'Pf3D7_14_v3:g.2480289T>A', 'annotation': [], 'gene': 'ARPS10'}], 'gene': 'ARPS10'}], {'chrom': 'Chromosome:', 'pos': 'Genome Position', 'gene_id': 'Locus Tag', 'gene': 'Gene Name', 'change': 'Change', 'freq': 'Estimated fraction'}, 'Other variants', Undefined)Mutations |
|---|---|
| UBP1 |
c.348A>G
p.Asn157Lys
c.699_700insAATAGTATTAATAATAGTATTAAT
c.1162_1164dupGAT
p.Tyr615His
p.Arg1133Ser
c.3849T>C
p.Lys1914Asn
p.Glu1915Lys
p.Arg2238Lys
c.9365_9391delGTATGAATCATGCAAACCGTGTGAGTC
|
| PF3D7_0109800 |
c.-165A>G
c.704_706dupATA
|
| CARL |
c.-106_-105delAT
p.Lys903Glu
|
| DHFR-TS |
c.429T>C
|
| PI4K |
p.His24Leu
c.2628C>T
p.Asn877Asp
c.3159C>T
c.3689_3691dupATA
c.4668T>C
|
| MDR1 |
p.Asp650Asn
p.Asn652Asp
c.2157C>T
|
| PF3D7_0720700 |
c.2175C>G
p.Asn991Asp
c.3890_3891insAAACAATGT
c.5028_5036delTGTAAAAAG
c.6033C>A
|
| PPPK-DHPS |
c.-131_-130delAT
c.426G>A
|
| PF3D7_0813000 |
c.1229_1237dupATAATATGA
c.491_502delGAGATAAAGATA
|
| PF3D7_1025000 |
p.Arg859Lys
c.1950A>T
p.Asn566Asp
p.Asn565Asp
p.Tyr563Asp
p.Thr562Glu
p.Asn558Asp
p.AsnAsn556LysTyr
p.Asn556Thr
p.Asp555Asn
p.Tyr554Asn
p.Thr553Lys
p.Asn549Asp
p.AsnAsn547LysTyr
p.Asn547Thr
c.1631_1636delCATATG
p.Phe486Ser
p.Gly334Glu
|
| PF3D7_1036800 |
p.Thr459Ile
p.Arg104Lys
|
| PF3D7_1138700 |
p.Ser1721Ala
p.Glu1049Asp
p.Ser633Asn
p.Glu497Gln
c.1359T>C
|
| ATP4 |
p.Gly1128Arg
p.Gln1081Lys
c.-88A>C
c.-90C>A
|
| PRS |
c.201G>A
c.-62G>A
c.-196_-177delAATATATATATATATATATA
|
| PF3D7_1246300 |
c.1041T>C
|
| PF3D7_1251200 |
c.-42_-41insATATAT
p.Ser183Gly
c.636A>G
|
| K13 |
p.Lys189Thr
c.-55A>T
c.-59A>T
c.-104_-75delAATATATATATATATATATATATATATATA
|
| MCA2 |
p.Asp226Glu
c.904_906delAAT
p.Glu1062Gln
p.Asn1085Asp
c.3636C>T
c.3648T>C
c.3684C>T
p.Glu1339Ala
p.Thr1362Ile
c.4305G>A
|
| eEF2 |
c.-118_-117insAT
|
| ARPS10 |
c.-151T>A
|
QC failed variants
| Gene | Mutations |
|---|---|
| UBP1 |
|
| DHFR-TS |
|
| PI4K |
|
| CRT |
|
| PF3D7_0720700 |
|
| PF3D7_0813000 |
|
| PF3D7_1025000 |
|
| PF3D7_1036800 |
|
| PF3D7_1204400 |
|
| PF3D7_1246300 |
|
| PF3D7_1251200 |
|
| PF3D7_1318100 |
|
| RAB11a |
|
| MCA2 |
|
Missing positions report
| Gene | Mutations |
|---|
Western Africa - 100.0%
| Process | Software |
|---|---|
| Software | {'taxonomic_software': 'sourmash', 'trimming': 'trimmomatic', 'mapping': 'bwa', 'variant_calling': 'freebayes-Haplotype', 'depth_calculation': 'samtools'} |
| Gene | Percentage depth passed | Median Depth |
|---|---|---|
| UBP1 | 99.92 | 40.0 |
| PF3D7_0109800 | 100.0 | 38.0 |
| CARL | 100.0 | 33.0 |
| DHFR-TS | 100.0 | 43.0 |
| PI4K | 100.0 | 39.0 |
| MDR1 | 100.0 | 39.0 |
| DHODH | 100.0 | 43.0 |
| CRT | 99.48 | 24.0 |
| PF3D7_0720700 | 100.0 | 40.0 |
| PPPK-DHPS | 100.0 | 39.0 |
| PF3D7_0813000 | 100.0 | 38.0 |
| PF3D7_1025000 | 99.91 | 43.0 |
| PF3D7_1036800 | 100.0 | 35.0 |
| PF3D7_1113300 | 100.0 | 32.0 |
| PF3D7_1138700 | 100.0 | 42.0 |
| PF3D7_1204400 | 100.0 | 27.0 |
| ATP4 | 100.0 | 45.0 |
| PRS | 100.0 | 40.0 |
| AP2-MU | 100.0 | 34.0 |
| PF3D7_1246300 | 100.0 | 31.0 |
| PF3D7_1251200 | 100.0 | 36.0 |
| PF3D7_1318100 | 100.0 | 33.0 |
| RAB11a | 100.0 | 26.0 |
| K13 | 100.0 | 42.0 |
| MCA2 | 100.0 | 37.0 |
| eEF2 | 100.0 | 43.0 |
| ARPS10 | 100.0 | 29.0 |
| CYTB | 100.0 | 960.0 |
| Species | ANI | Abundance | Accession |
|---|---|---|---|
Plasmodium falciparum |
99.8 % |
35.68 |
Plasmodium_falciparum |